Tháng 5 06, 2022

Xuất bản trực tuyến 2018 ngày 15 tháng 3.   doi: 10.1155/2018/9419264
PMCID:   PMC5874985
PMI:   29736181

Cải thiện khả năng học tập và trí nhớ do  đông trùng hạ thảo  Xử lý polypeptide và cơ chế cơ bản

trừu tượng

nghiên cứu trước đây của chúng tôi tiết lộ rằng  đông trùng hạ thảo militaris  có thể cải thiện khả năng học tập và trí nhớ, và mặc dù thành phần hoạt chất chính phải là phức hợp polypeptide của nó, nhưng cơ chế hoạt động cơ bản của nó vẫn chưa được hiểu rõ. Trong nghiên cứu này, chúng tôi khám phá các cơ chế mà theo đó  đông trùng hạ thảo militaris  cải thiện khả năng học tập và trí nhớ trong mô hình chuột. Chuột được tiêm scopolamine hydrobromide trong màng bụng để thiết lập mô hình chuột về khả năng học tập và suy giảm trí nhớ. tác dụng của  đông trùng hạ thảo  polypeptide trong mô hình này đã được thử nghiệm bằng thử nghiệm mê cung nước Morris; hoạt động superoxide dismutase huyết thanh; nồng độ malondialdehyd trong huyết thanh; hoạt động của acetyl cholinesterase, Na+-k+-ATPase và nitric oxide synthase; và hàm lượng axit gamma aminobutyric và glutamate trong mô não. Ngoài ra, các gen được biểu hiện khác biệt và các lộ trình truyền tín hiệu tế bào liên quan đã được sàng lọc bằng cách sử dụng chip hồ sơ biểu hiện mRNA. Kết quả cho thấy các gen  Pik3r5 ,  Il-1β , và  Slc18a2  đã tham gia vào các tác động của  đông trùng hạ thảo  polypeptide trên hệ thần kinh của những con chuột này. Phát hiện của chúng tôi cho thấy rằng  đông trùng hạ thảo  polypeptide có thể cải thiện khả năng học tập và trí nhớ trong mô hình học tập và suy giảm trí nhớ của chuột do scopolamine gây ra bằng cách loại bỏ các gốc oxy tự do, ngăn ngừa tổn thương oxy hóa và bảo vệ hệ thần kinh.

1. Giới thiệu

Học tập và trí nhớ là một trong những chức năng chính của bộ não con người và cùng nhau, chúng đóng một vai trò quan trọng trong quá trình tiến hóa và phát triển sinh học [ ]. Học tập và trí nhớ là các hoạt động sinh lý cao hơn trong não và cũng là thành phần cốt lõi của chức năng nhận thức [ ]. Với tuổi tác ngày càng tăng, khả năng học tập và trí nhớ giảm sút là một hiện tượng phổ biến và hầu hết dân số đã bị ảnh hưởng bởi chứng mất trí nhớ [ ]. Hơn nữa, sự thiếu hụt nhận thức phát triển trong quá trình tiến triển của các bệnh thần kinh khác nhau, bao gồm bệnh Alzheimer (AD) và hội chứng Parkinson (PD) [ ]. Do đó, việc ngăn ngừa và điều trị sớm các triệu chứng suy giảm khả năng học tập và trí nhớ này đã thu hút nhiều sự chú ý, một phần do thị trường tiềm năng rất rộng lớn của chúng [ ].

Hiện nay, các loại thuốc thường được sử dụng trên lâm sàng để phòng ngừa và cải thiện tình trạng suy giảm khả năng học tập và trí nhớ bao gồm thuốc thu dọn gốc tự do, thuốc ngăn chặn sự hình thành lắng đọng amyloid beta, thuốc chủ vận thụ thể M và thuốc ức chế acetyl cholinesterase. Thật không may, một số loại thuốc dùng để điều trị suy giảm khả năng học tập và trí nhớ thường có tác dụng kém liên quan đến trí nhớ học tập, độc tính, tác dụng phụ bất lợi và không có tác dụng ngăn ngừa sự xuất hiện và tiến triển của các bệnh thần kinh. Các loại thuốc truyền thống của Trung Quốc đã cho thấy một số ưu điểm so với các loại thuốc truyền thống đối với các bệnh liên quan đến học tập và suy giảm trí nhớ [ ], chẳng hạn như tác dụng phụ ít hơn và ít nghiêm trọng hơn, nhiều mục tiêu hành động hơn và chi phí thấp. Do đó, có nhiều mối quan tâm trong việc xác định các loại thuốc hiệu quả trong số các loại thuốc truyền thống của Trung Quốc để ngăn ngừa và cải thiện khả năng học tập và trí nhớ bị suy giảm.  đông trùng hạ thảo militaris  (Phía bắc  Cordyceps sinensis ) là một loại thảo dược Trung Quốc ít được sử dụng hiện nay, với các hoạt tính sinh học như cải thiện khả năng miễn dịch [ ], kìm khuẩn [ ,   ], và hạ huyết áp [ ]. Các nghiên cứu trước đây của nhóm nghiên cứu của chúng tôi đã chứng minh rằng  đông trùng hạ thảo militaris  có thể cải thiện khả năng học tập và trí nhớ, và hoạt chất chính của nó có thể là các phức hợp polypeptide [ ].

Để điều tra cơ chế chịu trách nhiệm cho hiệu ứng này của  đông trùng hạ thảo militaris  về học tập và trí nhớ, trong nghiên cứu hiện tại, lần đầu tiên chúng tôi thiết lập một mô hình chuột về học tập mắc phải và suy giảm trí nhớ thông qua tiêm scopolamine hydrobromide trong phúc mạc. Sử dụng mô hình này, chúng tôi đã kiểm tra tác động của  đông trùng hạ thảo  polypeptide về khả năng học tập và ghi nhớ của chuột bằng cách quan sát hoạt động của superoxide dismutase (SOD) trong huyết thanh hành vi của chuột; hàm lượng malondialdehyde huyết thanh (MDA); các hoạt động của acetyl cholinesterase AChE, Na + -k + -ATPase và nitric oxide synthase nội mô (eNOS); và hàm lượng axit gamma aminobutyric (GABA) và glutamate (Glu) trong mô não chuột. Hơn nữa, những con chuột được điều trị bằng  đông trùng hạ thảo  polypeptit được điều chế thông qua phương pháp phân giải enzym và một microarray biểu hiện mARN được sử dụng để sàng lọc các gen biểu hiện khác biệt và các đường truyền tín hiệu liên quan trong mô não của chuột được điều trị. Nhìn chung, khả năng của  đông trùng hạ thảo  polypeptide để ngăn ngừa và cải thiện khả năng học tập và suy giảm trí nhớ ở chuột mô hình đã được xác nhận và dữ liệu thu được cho các cơ chế liên quan có thể cung cấp cơ sở lý thuyết quan trọng cho việc nghiên cứu và phát triển thêm về  đông trùng hạ thảo  polipeptit.

2. Vật liệu và phương pháp thí nghiệm

2.1. Vật liệu thí nghiệm

2.1.1. Động vật

Tổng cộng có 120 con chuột ICR đực 8 tuần tuổi (loại không chứa mầm bệnh cụ thể), nặng 18~22 g, được mua từ Công ty TNHH Công nghệ sinh học Trường Sinh Liaoning (số giấy phép: SCXK (Liao)-2015-0001) . Những con chuột được nhốt riêng trong môi trường có nhiệt độ được kiểm soát (20 ± 1°C) và độ ẩm (40–70%) và trải qua chu kỳ sáng/tối 12 giờ với quyền truy cập miễn phí thức ăn và nước uống. Nghiên cứu được thực hiện theo Nguyên tắc của Cộng đồng Châu Âu về Sử dụng Động vật Thí nghiệm và Ủy ban Đạo đức của Đại học Beihua đã phê duyệt đề cương nghiên cứu.

2.1.2.   đông trùng hạ thảo militaris

Quả thể của  đông trùng hạ thảo militaris  được mua từ Shenyang Nizi  đông trùng hạ thảo  Cơ Sở Tu Luyện.

2.1.3. Thuốc thử và dụng cụ

Viên nén Piracetam (Tập đoàn Dược phẩm Đông Bắc Shenyang First Pharmaceutical Co. Ltd.; số lô: 5141224); scopolamine hydrobromide (Công ty TNHH Công nghệ Sinh học Thành Đô Manchester Stewart, số lô: 150417) và pepsin (hoạt tính: 3000~3500 u/mg; Công ty TNHH Công nghệ Sinh học Trường Sinh Bắc Kinh Dingguo Changsheng); acetylcholinesterase (AChE),   γ -aminobutyric acid (GABA), Na+-K+-ATPase, axit glutamic (Glu), monoamine oxidase-B (MAO-B) và bộ xét nghiệm tổng hợp oxit nitric nội mô (eNOS) (Viện nghiên cứu các sản phẩm sinh học Shangle Thượng Hải, số lô : 30126078); bộ xét nghiệm malondialdehyd (MDA) và superoxide dismutase (SOD) (Viện nghiên cứu sản phẩm sinh học Jiancheng Nam Kinh, số lô: THZ-C); một bộ dao động nhiệt độ không đổi (Nhà máy thiết bị thí nghiệm Taicang); máy ly tâm Infinite M200 ELIASA (TECAN), máy ly tâm tốc độ cao nhiệt độ thấp 5430R (Công ty Eppendorf, Hoa Kỳ), cân điện tử AL204 (Công ty TNHH Mettler-Toledo Instruments) và thiết bị mê cung nước Morris (Công ty Chengdu Taimeng Technology Co. Ltd.) được sử dụng trong nghiên cứu này.

2.2. thí nghiệm động vật

2.2.1. chuẩn bị của  đông trùng hạ thảo  Polypeptit [ ]

Một lượng thích hợp của quả thể khô của  đông trùng hạ thảo militaris  được nghiền thành bột (40 mesh). Sau đó bột được khử chất béo bằng ete dầu hỏa và phần cặn được làm khô. Sau khi sấy khô, 50 g cặn khô được hòa tan trong 450 mL nước cất và dung dịch được điều chỉnh đến pH 2,0 bằng HCl 1 M. Sau đó, 10 g pepsin được thêm vào dung dịch ở 37°C để phân giải bằng enzym trong 5 giờ. Sau quá trình phân giải bằng enzym, dung dịch được đun nóng ở 100°C trong bể nước trong 10 phút để khử hoạt tính của pepsin. Tiếp theo, nó được lọc và được ly tâm để thu thập phần nổi phía trên và được đông khô để thu được  đông trùng hạ thảo  bột polypeptide (5,36 g).

2.2.2. Phân nhóm và quản lý động vật

Một trăm hai mươi con chuột được chia ngẫu nhiên thành sáu nhóm theo phương pháp điều trị: nhóm đối chứng trống, nhóm mô hình, nhóm đối chứng tích cực (thuốc), nhóm liều cao.  đông trùng hạ thảo  nhóm polypeptide (900 mg·kg −1 ), liều trung bình  đông trùng hạ thảo  nhóm polypeptide (450 mg·kg −1 ) và liều thấp  đông trùng hạ thảo  nhóm polypeptit (225 mg·kg −1 ). Những con chuột trong nhóm kiểm soát dương tính được cho uống thuốc kiểm soát dương tính Viên nén Piracetam với liều 600 mg·kg −1  (được tính toán dựa trên diện tích bề mặt cơ thể) và những con chuột trong nhóm mô hình và đối chứng trống nhận được cùng một lượng nước cất trong dạ dày một lần mỗi ngày trong 45 ngày liên tiếp.

2.2.3. Chuẩn bị mô hình động vật và huấn luyện động vật

Trước khi thử nghiệm hành vi, những con chuột được đặt trong thiết bị mê cung nước và được phép bơi tự do trong 2 phút trong 2 ngày liên tiếp, để chuột thích nghi với môi trường. Một tuần trước khi tiêm thuốc vào dạ dày, thử nghiệm mê cung nước bắt đầu. Vào lúc 1 giờ sau khi tiêm vào dạ dày, những con chuột trong nhóm đối chứng trống được tiêm nước muối (3 mL·kg −1 ) trong phúc mạc và những con chuột trong các nhóm khác được tiêm scopolamine hydrobromide (3 mg·kg −1 ) trong phúc mạc ) để thiết lập mô hình suy giảm trí nhớ và học tập của chuột, và 15 phút sau, thử nghiệm mê cung nước Morris được thực hiện trong 7 ngày liên tiếp.

2.2.4. Thử nghiệm mê cung nước Morris

Thiết bị mê cung nước Morris bao gồm hai phần, một ống hình trụ và thiết bị ghi âm. Ống hình trụ (đường kính 80 cm, cao 30 cm) được chia thành bốn góc phần tư (góc phần tư 1, 2, 3 và 4). Một bệ có đường kính 5 cm được đặt ở trung tâm của góc phần tư 3. Trước khi thử nghiệm, ống được đổ đầy nước đến 11 cm bên dưới mép. Nhiệt độ nước được duy trì ở 20 ± 2°C và một lượng titan dioxit thích hợp được thêm vào nước để làm cho nước có màu ngà. Nền tảng được đặt ở 1-2 cm dưới mặt nước. Khi tiến hành thử nghiệm, môi trường xung quanh được giữ nguyên.

Thử nghiệm Điều hướng Định vị . Thử nghiệm được thực hiện vào ngày 1–6. Trước khi bắt đầu thử nghiệm, những con chuột được phép ở trên bệ trong 30 giây. Sau đó, những con chuột được thả xuống nước đối diện với thành bể ở hai góc phần tư bất kỳ ngoại trừ góc phần tư chứa bục. Độ trễ thoát trong vòng 120 giây đã được ghi lại và các giá trị độ trễ thoát trung bình được tính làm chỉ số đánh giá.

Vào ngày thứ 7, thử nghiệm tìm kiếm không gian đã được thực hiện. Đối với văn bản này, nền tảng đã được gỡ bỏ và sau đó những con chuột được đặt xuống nước trong một góc phần tư cố định, đối diện với bức tường của hồ bơi. Số lượng lỗi do chuột mắc phải khi đi qua vị trí đặt nền tảng trong vòng 120 giây đã được ghi lại và các giá trị trung bình được tính làm chỉ số đánh giá.

2.2.5. Phương pháp lấy mẫu động vật và phát hiện chỉ số sinh hóa

Sau thử nghiệm mê cung nước Morris, nhãn cầu của những con chuột được lấy ra bằng kẹp sạch để lấy 1 mL máu toàn phần. Các mẫu máu được ly tâm với tốc độ 3000 vòng/phút ở 4°C trong 10 phút để thu được huyết thanh và các mẫu huyết thanh được bảo quản ở -20°C cho đến khi sử dụng. Toàn bộ mô não của chuột được thu hoạch, cân và chuẩn bị thành hỗn hợp đồng nhất 10% khi bổ sung nước muối theo tỷ lệ 1:9 (w:v) trong bể nước đá. Chất đồng nhất được ly tâm ở tốc độ 3500 vòng/phút ở 4°C trong 10 phút để thu được phần nổi phía trên và phần nổi phía trên được bảo quản ở -80°C cho đến khi sử dụng. Theo hướng dẫn dành cho bộ dụng cụ phát hiện, hoạt động SOD huyết thanh và hàm lượng MDA được đo, hoạt động AChE, Na + -k + -ATP và eNOS được đánh giá, đồng thời xác định hàm lượng GABA và Glam trong các mô não theo hướng dẫn dành cho bộ dụng cụ phát hiện hướng dẫn về bộ xét nghiệm miễn dịch hấp thụ liên kết với enzyme.

2.3. Chiết xuất RNA và kiểm soát chất lượng

Tổng RNA gan được chiết xuất bằng thuốc thử Trizol (Invitrogen, Gaithersburg, MD, USA) bằng cách làm theo hướng dẫn vận hành. Mô gan được nghiền thành bột trong điều kiện đông lạnh nitơ lỏng, và bột được chuyển vào ống ly tâm 1,5 mL trong đó Trizol (500 mg mô gan trên 0,5 mL Trizol) đã được thêm vào trước khi nitơ lỏng bay hơi hoàn toàn. Mô gan-Trizol homogenate được hút mạnh nhiều lần bằng ống tiêm dùng một lần 5 mL cho đến khi homogenate không còn dính nữa, để phá vỡ hoàn toàn các tế bào và DNA bộ gen, được giữ ở nhiệt độ phòng để sử dụng. Cloroform được thêm vào homogenate theo tỷ lệ 200 μL chloroform trên 1 mL Trizol được sử dụng, được lắc mạnh trong 30 giây để được trộn đều, giữ ở nhiệt độ phòng trong 5 phút, sau đó ly tâm ở 12000 vòng / phút trong 15 phút để lấy phần nổi phía trên. Dịch nổi được chuyển cẩn thận sang một ống ly tâm khác, và cần chú ý nhiều hơn đến việc hút dịch nổi để tránh lấy mesophase. Chất nổi trên bề mặt được thêm 500 uL isopropanol để kết tủa ở nhiệt độ phòng trong 10 phút; dung dịch được ly tâm ở tốc độ 12000 vòng / phút trong 15 phút và phần nổi phía trên được loại bỏ; phần cặn được thêm 1 mL ethanol 75% để rửa RNA, được dao động bởi dao động xoáy, giữ ở nhiệt độ phòng trong 5 phút, sau đó ly tâm với tốc độ 7500 vòng / phút trong 5 phút; phần nổi phía trên được loại bỏ và phần cặn được thêm vào 1 mL etanol 75% để được rửa lại một lần nữa. Dung dịch ethanol cặn được ly tâm ở tốc độ 7500 vòng / phút trong 5 phút, phần nổi phía trên được loại bỏ và cặn được làm khô ở nhiệt độ phòng. Xin lưu ý rằng kết tủa RNA không được quá khô; nếu không, nó sẽ không dễ dàng bị hòa tan.

RNA được hòa tan trong một lượng dung dịch đệm TE thích hợp (10 mmol/L Tris, pH7,6, 1 mmol/L EDTA). Tổng khối lượng RNA được phát hiện bằng điện di trên gel agarose và mRNA được tinh chế theo hướng dẫn của RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Theo hướng dẫn của bộ công cụ, chất lượng của các mẫu RNA đã được đánh giá và phát hiện tính toàn vẹn của các mẫu RNA, chất ức chế và ô nhiễm DNA. Chất lượng của mRNA được phát hiện bằng điện di trên gel RNA formaldehyde-agarose và hàm lượng RNA được xác định bằng phép đo quang phổ UV. Cùng một lượng RNA lấy từ mỗi con chuột trong mỗi nhóm được trộn lẫn và sau đó được sử dụng để phát hiện chip.

2.4. Phân tích chip gen

2.4.1. Dán nhãn và lai tạo mẫu

Trước khi ghi nhãn RNA, Agilent ND-1000 đã được sử dụng để phát hiện sự phân hủy RNA và xác định nồng độ RNA. Để phân tích chip gen, các mẫu được dán nhãn bằng bộ dán nhãn Agilent Quick Amp và lai với Agilent SureHyb.

Ghi nhãn mẫu và lai tạo mảng được thực hiện theo giao thức Phân tích biểu hiện gen dựa trên microarray một màu Agilent (Công nghệ Agilent). Tóm lại, tổng số RNA từ mỗi mẫu được khuếch đại tuyến tính và được dán nhãn Cy3-UTP. Các cRNA được dán nhãn đã được tinh chế bằng RNeasy Mini Kit (Qiagen). Nồng độ và hoạt tính cụ thể của cRNA được dán nhãn (pmol Cy3/ μ g cRNA) được đo bằng NanoDrop ND-1000. 1 μ g của mỗi cRNA được dán nhãn đã được phân mảnh bằng cách thêm 11 μ l Chất chặn 10x và 2,2 μ l dung dịch đệm phân mảnh 25x, sau đó được gia nhiệt ở 60°C trong 30 phút, và cuối cùng, đệm lai hóa 55 μ L 2x GE được thêm vào để pha loãng cRNA được dán nhãn. 100 μ L dung dịch lai được phân phối vào phiến đệm và được lắp ráp vào phiến microarray biểu hiện gen. Các phiến kính được ủ trong 17 giờ ở 65°C trong Lò lai hóa Agilent. Các mảng lai được rửa, cố định và quét bằng Máy quét vi mảng DNA Agilent (số bộ phận G2505C).

2.4.2. Thu thập và chuẩn hóa dữ liệu

Sau khi rửa, con chip được quét bằng Máy quét vi mảng DNA Agilent. Phần mềm Trích xuất Tính năng Agilent (v11.0.0.1) được sử dụng để thu các giá trị tín hiệu đầu dò chip và phần mềm Agilent Gene Spring GX v12.1 được sử dụng để chuẩn hóa kết quả chip. Các điểm nằm ngoài khoảng tin cậy 95% đại diện cho các gen biểu hiện khác nhau.

2.4.3. Phân tích ý nghĩa chức năng của các gen biểu hiện khác nhau

Chú thích bản thể gen (GO) của các gen được biểu hiện khác nhau đã được thực hiện bằng cách sử dụng cơ sở dữ liệu Bản thể gen gen NCBI để xác định tất cả các danh mục GO có liên quan đến các gen và thử nghiệm chính xác của Fisher và   x 2  kiểm tra đã được áp dụng để tính mức ý nghĩa và tỷ lệ lỗi cho mỗi GO. Tỷ lệ lỗi sau đó được sử dụng để hiệu chỉnh   P  các giá trị, do đó sàng lọc các loại GO quan trọng được phản ánh bởi các gen được biểu hiện khác nhau ( P  < 0,05) [ ]. Các kết quả thí nghiệm được phân tích bằng cơ sở dữ liệu của Viện Tin sinh học Châu Âu (EBI) [ ].

2.4.4. Phân tích làm giàu con đường chức năng và sinh học của các gen biểu hiện khác nhau được xác định bởi chip biểu hiện mRNA bằng DAVID

Từ cơ sở dữ liệu DAVID mở ( https://david.ncifcrf.gov/ ), 450 gen đã được gửi trong bộ gen để phân tích thêm, đồng thời, mã định danh gen tương ứng (mã định danh gen tương ứng với tên gen OFFICIAL_GENE_SYMBOL) đã được lựa chọn. Bộ gen hoàn chỉnh của chuột đã được chọn bao gồm các gen nền, sau đó “Công cụ chú thích chức năng” được áp dụng làm công cụ phân tích, để có thể thu được kết quả phân tích làm giàu GO và phân tích làm giàu con đường của các gen biểu hiện khác nhau [ ].

2.5. Xác minh phản ứng chuỗi polymerase định lượng thời gian thực (PCR)

Xác nhận PCR định lượng thời gian thực về biểu hiện khác biệt của các gen cụ thể liên quan đến điều hòa miễn dịch đạt được bằng cách  đông trùng hạ thảo  polypeptide ở chuột được thực hiện theo đúng hướng dẫn cho Real-time PCR Master Mix (SYBR Green, Toyobo) [ ]. Thiết bị được sử dụng là Roche Light Cycler 1.5 và trình tự mồi được cung cấp trong   Bảng 1 .

Bảng 1

Cặp mồi cho PCR định lượng thời gian thực.

tên gen Trình tự mồi hai chiều Nhiệt độ ủ (°C) Kích thước sản phẩm (bp)
Pik3r5 F: 5′ CGGCTTCTTACTACTTCAACTTCCA3′
R: 5′ CGGAGGAAGACTTGATAAAACAGAC3′
60 71
Il-1β F: 5′ CTTCAGGCAGGCAGTATCACTC3′
R: 5′ GCAGTTGTCTTAATGGGAACGTC3′
60 194
Slc18a2 F: 5′ TCACCAACCCATTCTAGGACT3′
R: 5′ ATGAGCAAGAGGAGCCGATT3′
60 168

2.6. Phân tích thống kê

Các phân tích thống kê được thực hiện bằng phần mềm thống kê SPSS 16.0 (SPSS, Inc.). Phân tích phương sai một nhân tố và   q  kiểm tra dữ liệu đo được thực hiện với chương trình phân tích phương sai (ANOVA) và chênh lệch bình phương nhỏ nhất được sử dụng để so sánh theo cặp. Dữ liệu xếp hạng được phân tích bởi Rid it.   P  < 0,05 được coi là có ý nghĩa thống kê [ ].

3. Kết quả thí nghiệm

3.1. Ảnh hưởng của  đông trùng hạ thảo  Polypeptide về hành vi của chuột bị suy giảm khả năng học tập và trí nhớ

Trong thử nghiệm điều hướng định vị vào ngày 1–6, độ trễ thoát trong 3 ngày đầu tiên không khác nhau giữa những con chuột trong các nhóm khác nhau, nhưng vào ngày 4–6, độ trễ thoát của chuột trong nhóm mô hình kéo dài đáng kể so với của những con chuột trong nhóm đối chứng ( P  < 0,01), cho thấy mô hình đã được thiết lập thành công. Vào ngày thứ 4 và thứ 5, độ trễ trốn thoát của chuột ở cả liều cao  đông trùng hạ thảo  nhóm polypeptide và nhóm thuốc dương tính cũng ngắn hơn đáng kể so với chuột trong nhóm mô hình ( P  < 0,05). Đến ngày thứ 6, độ trễ thoát của chuột trong tất cả  đông trùng hạ thảo  nhóm được điều trị bằng polypeptide và nhóm dùng thuốc dương tính bị rút ngắn đáng kể so với nhóm chuột trong nhóm mô hình ( P  < 0,05). Trong thử nghiệm tìm kiếm không gian vào ngày thứ 7, số lần chuột di chuyển qua bệ trong nhóm mô hình ít hơn đáng kể so với nhóm đối chứng ( P  < 0,05), trong khi số lần băng qua sân ga ở liều cao  đông trùng hạ thảo  nhóm polypeptide và nhóm thuốc dương tính lớn hơn đáng kể so với nhóm đối chứng ( P  < 0,05;   Bảng 2 ).

ban 2

Kết quả kiểm tra mê cung nước Morris.

Nhóm Độ trễ thoát (s) Băng qua sân ga (lần)
ngày thứ 4 ngày thứ 5 ngày thứ 6 ngày thứ 7
CON 38,12 ± 34,65 33,26 ± 22,16 30,17 ± 22,80 4,20 ± 3,65
m 85,56 ± 43,75 ∗∗ 74,33 ± 50,61 ∗∗ 71,14 ± 50,13 ∗∗ 1,54 ± 1,63
L-CP 74,55 ± 49,26 52,62 ± 49,60 51,07 ± 44,34 # 2,54 ± 2,47
M-CP 78,87 ± 48,13 54,87 ± 43,41 49,98 ± 35,91 # 1,93 ± 2,02
H-CP 59,86 ± 51,48 # 47,30 ± 47,55 # 39,61 ± 39,12 # 3,25 ± 1,86 #
máy tính 58,23 ± 40,16 # 48,64 ± 39,73 # 38,14 ± 26,66 # 2,64 ± 3,22 #

  P  <0,05 so với nhóm kiểm soát trống,   ∗∗ P  <0,05 so với nhóm kiểm soát trống,   # P  < 0,05 so với nhóm mô hình; CON: nhóm kiểm soát trống; M: nhóm người mẫu; L-CP: nhóm CP liều thấp; M-PC: nhóm CP liều trung bình; H-CP: nhóm CP liều cao; PC: nhóm kiểm soát tích cực.

3.2. Ảnh hưởng của  đông trùng hạ thảo  Polypeptide trên Hoạt động SOD huyết thanh và Hàm lượng MDA

So với những con trong nhóm kiểm soát trống, hoạt tính SOD huyết thanh trong huyết thanh của chuột giảm đáng kể và hàm lượng MDA tăng đáng kể ở những con chuột của nhóm mô hình ( P  < 0,05), khẳng định thêm rằng mô hình đã được thiết lập thành công. So với những người trong nhóm mô hình, hoạt động SOD trong huyết thanh đã tăng lên đáng kể và hàm lượng MDA đã giảm đáng kể ở liều cao  đông trùng hạ thảo  nhóm polypeptide và nhóm đối chứng dương tính ( P  < 0,05;   Bảng 3 ).

bàn số 3

Ảnh hưởng của   đông trùng hạ thảo  polypeptide trên hoạt động SOD huyết thanh và hàm lượng MDA ở chuột.

Nhóm SOD (U/mL) MDA (nmol/mL)
CON 128,72 ± 17,13 5,15 ± 0,91
m 105,19 ± 12,38 6,48 ± 0,86
L-CP 116,73 ± 13,16 5,57 ± 1,08
M-CP 118,20 ± 25,22 5,66 ± 0,89
H-CP 127,57 ± 18,35 # 4,99 ± 1,51 #
máy tính 132,44 ± 16,48 # 5,16 ± 0,94 #

  P  <0,05 so với nhóm kiểm soát trống,   # P  < 0,05 so với nhóm mô hình; CON: nhóm kiểm soát trống; M: nhóm người mẫu; L-CP: nhóm CP liều thấp; M-PC: nhóm CP liều trung bình; H-CP: nhóm CP liều cao; PC: nhóm kiểm soát tích cực.

3.3. Ảnh hưởng của  đông trùng hạ thảo  Polypeptide trên các hoạt động của AChE, Na + -k + -ATPase và eNOS cũng như GABA và nội dung Glu trong mô não của chuột

Hoạt tính AChE cao hơn đáng kể ( P  < 0,05), hoạt động của Na + -k + -ATPase và eNOS thấp hơn đáng kể ( P  < 0,05) và hàm lượng GABA và Glu thấp hơn đáng kể ( P  < 0,05) trong mô não của những con chuột trong nhóm mô hình so với những con trong nhóm kiểm soát trống, cũng xác nhận rằng mô hình đã được thiết lập thành công. So với những người trong nhóm mô hình, các hoạt động AChE đã giảm đáng kể ( P  < 0,05), các hoạt động của Na + -k + -ATPase và eNOS tăng lên đáng kể, đồng thời hàm lượng GABA và Glu cũng tăng lên đáng kể ( P  < 0,05) trong mô não của chuột ở liều cao  đông trùng hạ thảo  nhóm polypeptide và nhóm kiểm soát dương tính. Tuy nhiên, trong số các chỉ số này, chỉ có hoạt tính Na + -k + -ATPase là tăng đáng kể trong mô não của chuột ở liều thấp.  đông trùng hạ thảo  nhóm polypeptide so với nhóm mô hình ( P  < 0,05). Các dữ liệu tương ứng được trình bày trong   Bảng 4 .

Bảng 4

Ảnh hưởng của   đông trùng hạ thảo  polypeptide trên các hoạt động của AChE, Na + -k + -ATPase và eNOS cũng như hàm lượng GABA và Glu trong mô não của chuột.

Nhóm Đau (ng/mL) Na + -k + -ATP (ng/mL) eNOS (U/mL) GABA (ng/mL) Keo (nmol/mL)
CON 15,41 ± 0,71 16,42 ± 1,65 4,62 ± 0,50 85,73 ± 5,87 60,05 ± 3,71
m 16,63 ± 0,87 13,87 ± 2,11 4,04 ± 0,45 76,33 ± 8,80 4,77 ± 5,14
L-CP 15,64 ± 0,94 16,96 ± 2,18 # 4,60 ± 0,55 84,61 ± 4,46 # 58,25 ± 3,63
M-CP 15,59 ± 0,75 16,11 ± 2,83 4,62 ± 0,63 84,60 ± 7,99 58,13 ± 4,93
H-CP 15,43 ± 0,90 # 16,77 ± 1,81 # 4,65 ± 0,44 # 87,98 ± 6,45 # 60,71 ± 1,09 #
máy tính 15,35 ± 0,56 # 17,34 ± 3,17 # 4,70 ± 0,66 # 85,24 ± 4,99 # 60,98 ± 4,34 #

  P  <0,05 so với nhóm kiểm soát trống,   # P  < 0,05 so với nhóm mô hình; CON: nhóm kiểm soát trống; M: nhóm người mẫu; L-CP: nhóm CP liều thấp; M-PC: nhóm CP liều trung bình; H-CP: nhóm CP liều cao; PC: nhóm kiểm soát tích cực.

3.4. Kết quả chip mRNA

Như thể hiện trong   Hình 1 , so với nhóm mô hình, có 450 gen biểu hiện khác nhau trong mô não của chuột ở nhóm  đông trùng hạ thảo  nhóm được điều trị bằng polypeptide, trong đó sự biểu hiện của 175 gen (38,89%) được điều hòa tăng đáng kể và của 275 gen (61,11%) được điều hòa giảm đáng kể. Sự khác biệt trong kết quả chip mRNA là đáng kể giữa  đông trùng hạ thảo  nhóm được điều trị bằng polypeptide và nhóm mô hình, và kết quả cho thấy rằng  đông trùng hạ thảo  polypeptide có thể ức chế đáng kể mức độ biểu hiện của các gen liên quan đến hệ thần kinh (sự biểu hiện của 61,11% gen bị điều hòa quá mức).

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is ECAM2018-9419264.001.jpg

Kết quả phân tích microarray hồ sơ biểu hiện mRNA (M: nhóm người mẫu; CP:  đông trùng hạ thảo  nhóm polipeptit).

3.5. Kết quả phân cụm

Phân tích cụm GO của 450 gen biểu hiện khác nhau đã được thực hiện bằng cách sử dụng cơ sở dữ liệu DAVID và 36 con đường liên quan đã được tìm thấy. Bảy trong số những con đường này có liên quan trực tiếp đến chức năng miễn dịch. Phân tích thống kê đối với các gen liên quan đến bảy con đường này cho thấy nhiều gen liên quan đến nhiều hơn một trong bảy con đường và phân tích sâu hơn cho thấy rằng các con đường liên quan đến ba gen (PIK3R5, IL-1B và SLC18A2) là nhiều nhất ( Bảng 5 ).

Bảng 5

Sàng lọc ra các gen đại diện.

KHÔNG. tên gen số lượng con đường Tên đường dẫn
1 Pik3r5 4 Bệnh Chagas (bệnh sán lá gan Mỹ) nhiễm toxoplasma tự nhiên
Di chuyển qua nội mô bạch cầu
khớp thần kinh dopaminergic
2 Il-1β 3 Bệnh Chagas (bệnh sán lá gan Mỹ) nhiễm toxoplasma tự nhiên
bệnh Prion
3 Slc18a2 3 Bệnh Chagas (bệnh sán lá gan Mỹ)
Di chuyển qua nội mô bạch cầu
khớp thần kinh dopaminergic

3.6. Xác minh PCR định lượng theo thời gian thực

Xác nhận PCR định lượng thời gian thực biểu hiện của ba gen, bao gồm  Pik3r5 ,  Il-1β , và  Slc18a2 , đã được tiến hành. Như thể hiện trong   Bảng 6 , các  Pik3r5    Il-1β  mức độ biểu hiện đã được tìm thấy là thay đổi đáng kể trong mô não của những con chuột trong nhóm mô hình ( P  = 0,015997,   P  = 0,001177) với tỷ lệ biểu thức lần lượt là 0,8 và 0,12 giữa  đông trùng hạ thảo  nhóm mô hình và nhóm được điều trị bằng polypeptide ( Hình 2 ), và điều này dẫn đến sự điều chỉnh tiêu cực đối với hoạt động miễn dịch. Các  Slc18a2  gen đã được điều chỉnh tăng đáng kể trong mô não của những con chuột bị suy giảm khả năng học tập và trí nhớ ( P  = 0,002095 với tỷ lệ biểu thức là 1,79 giữa  đông trùng hạ thảo  nhóm được xử lý bằng polypeptide và nhóm mô hình).

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is ECAM2018-9419264.002.jpg

Xác nhận PCR định lượng thời gian thực của  Pik3r5 ,  Il-1b , và  Slc18a2  gen (M: nhóm người mẫu; CP:  đông trùng hạ thảo  nhóm polipeptit;   ∗∗ P  < 0,01).

Bảng 6

Kết quả thực nghiệm PCR định lượng real-time.

Sơ đồ so sánh dữ liệu Pik3r5 Il-1b Slc18a2
m 1,59 E  − 02 5.51 E  − 04 1.04E  − 04
CP 1,27 E  − 02 6,62 Đ  − 05 1,86 E  − 04
CP/Tháng 0,80 0,12 1,79
P  giá trị 0,0002353 0,001177 0,002095

M: nhóm người mẫu; CP:   đông trùng hạ thảo  nhóm polipeptit.

4. Thảo luận

Với sự gia tăng áp lực xã hội và tỷ lệ mắc các bệnh khác nhau, ngày càng có nhiều người, không chỉ người già mà cả thanh thiếu niên, bắt đầu trải qua các triệu chứng suy giảm trí nhớ. Do đó, cần có thuốc hoặc các thành phần tích cực có thể cải thiện khả năng học tập và trí nhớ. Các nghiên cứu đã chỉ ra rằng  đông trùng hạ thảo militaris  tăng cường khả năng miễn dịch chống lão hóa và thúc đẩy điều hòa tim mạch, nhưng có rất ít báo cáo về tác dụng của  đông trùng hạ thảo  polypeptide về học tập và trí nhớ theo kiến ​​​​thức của chúng tôi. Trong nghiên cứu hiện tại, scopolamine hydrobromide đã được sử dụng để thiết lập một mô hình suy giảm khả năng học tập và trí nhớ của chuột, và ảnh hưởng của  đông trùng hạ thảo  polypeptide đối với khả năng học tập và trí nhớ ở những con chuột này đã được nghiên cứu từ hai góc độ, đó là góc độ hành vi trong thử nghiệm mê cung nước Morris và phát hiện phân tử của các chỉ số sinh hóa liên quan. Thử nghiệm mê cung nước Morris cho thấy rằng  đông trùng hạ thảo polypeptide  có thể rút ngắn độ trễ để tìm nền tảng và tăng số lần giao cắt tại nơi đặt nền tảng trước đó, cho thấy rằng  đông trùng hạ thảo  polypeptide có thể cải thiện khả năng học tập và trí nhớ của những con chuột bị suy giảm trí nhớ và học tập do scopolamine gây ra.

SOD tham gia vào quá trình loại bỏ các gốc oxy tự do trong cơ thể và do đó ngăn chặn quá trình peroxy hóa lipid và bảo vệ màng tế bào khỏi bị hư hại do oxy hóa [ ]. MDA là một trong những sản phẩm của quá trình peroxy hóa lipid gây ra khi bị thương và có thể làm tổn thương màng tế bào trầm trọng hơn. Do đó, phép đo hoạt động SOD và hàm lượng MDA có thể được sử dụng để đánh giá tác dụng chống oxy hóa. AChE là một chất dẫn truyền thần kinh có liên quan chặt chẽ đến chức năng học tập và ghi nhớ, hàm lượng AChE tăng lên có thể làm tổn thương dây thần kinh cholinergic, gây suy giảm nhận thức, có nghĩa là AChE có thể được sử dụng như một chỉ số để đánh giá lại khả năng học tập và trí nhớ [ ]. GABA và Glam lần lượt là các chất dẫn truyền thần kinh ức chế và kích thích trung tâm, và sự cân bằng trong biểu hiện của chúng đóng vai trò quan trọng trong việc duy trì các chức năng bình thường của hệ thần kinh trung ương. Na + -k + -ATPase, còn được gọi là bơm natri-kali, nằm trong màng tế bào và tham gia vào quá trình cung cấp năng lượng. Hơn nữa, nó có thể làm tăng lưu lượng máu não, thúc đẩy quá trình chuyển hóa năng lượng của não, cải thiện chức năng học tập và trí nhớ. eNOS xúc tác quá trình tổng hợp NO trong cơ thể sống với tác dụng bảo vệ hệ thần kinh [ ]. Thúc đẩy hoạt động của eNOS có thể làm tăng giải phóng NO để bảo vệ các tế bào thần kinh. Kết quả của chúng tôi cho thấy rằng  đông trùng hạ thảo  polypeptide có thể cải thiện hoạt động SOD huyết thanh, giảm hàm lượng MDA và hoạt động AChE trong não chuột, tăng hoạt động Na + -k + -ATPase và eNOS, đồng thời tăng biểu hiện GABA và Glam, cho thấy rằng  đông trùng hạ thảo  polypeptide có thể cải thiện khả năng học tập và trí nhớ ở những con chuột mắc chứng rối loạn học tập và trí nhớ.

Trong nghiên cứu hiện tại, thông qua phân tích microarray biểu hiện mRNA, tổng số 450 gen biểu hiện khác nhau đã được xác định giữa các  đông trùng hạ thảo  nhóm được điều trị bằng polypeptide và nhóm người mẫu. Sau đó, 36 con đường liên quan đã được tiết lộ thông qua phân tích cụm cho chức năng gen và các con đường liên quan đến ba gen  Pik3r5 ,  Il-1β , và  Slc18a2  tồn tại là nhiều nhất. Phân tích PCR định lượng thời gian thực biểu hiện của  Pik3r5 ,  Il-1β , và  Slc18a2  tiếp tục chỉ ra rằng ba gen này đều là những yếu tố chính trong tác động của  đông trùng hạ thảo  polypeptide trên hệ thần kinh trong mô hình chuột học tập và suy giảm trí nhớ.

Il-1β  là một cytokine được tiết ra bởi các tế bào T helper 1 (Th1) để thúc đẩy phản ứng viêm. Các nghiên cứu đã chỉ ra rằng  Il-1β  có thể liên quan đến quá trình sinh lý bệnh trầm cảm và đáp ứng với điều trị chống trầm cảm liên quan đến việc giảm chức năng của hệ thống 5-HT, kích hoạt trục dưới đồi-tuyến yên-thượng thận (HPA) và ảnh hưởng đến quá trình tái tạo tế bào thần kinh [ ]. Các báo cáo bổ sung đã chứng minh rằng chấn thương thời thơ ấu có thể làm tăng mức độ của các cytokine in vivo và ảnh hưởng đến quá trình trầm cảm và hiệu quả điều trị của thuốc chống trầm cảm. Phân tích chip mRNA của chúng tôi trong nghiên cứu này xác nhận rằng  đông trùng hạ thảo  polypeptide có thể ức chế sự biểu hiện của một gen, có thể thuận lợi cho việc tái tạo tế bào thần kinh và đóng vai trò bảo vệ hệ thần kinh, nhờ đó  đông trùng hạ thảo  polypeptide có thể cải thiện khả năng học tập của chuột và trí nhớ của chuột [ ].

Các  Slc18a2  gen nằm ở vùng nhiễm sắc thể 10q25.3 và mã hóa chất vận chuyển monoamin dạng túi 2 (VMAT2) có thể vận chuyển dopamin. Nó cũng mã hóa epinephrine và serotonin đi qua màng vào các túi tiếp hợp và tham gia vào quá trình chuyển hóa monoamine. Người ta đã báo cáo rằng vai trò sinh lý của các monoamines này có liên quan đến kiểm soát vận động, ổn định tâm trạng và các chức năng tự chủ. Hoạt động bình thường của quá trình này là điều cần thiết để duy trì sự trao đổi chất dopamin trong các tế bào thần kinh provia nigra.

Slc18a2  biểu hiện gen đã được báo cáo là làm giảm rối loạn vận động và hành vi giống như trầm cảm trong mô hình chuột [ ].  Slc18a2  biểu hiện gen cũng được chứng minh là thúc đẩy quá trình bài tiết chất dẫn truyền thần kinh khi công nghệ chip gen được áp dụng để quan sát tác động của thạch tín đối với hồ sơ biểu hiện của gen liên quan đến chất dẫn truyền thần kinh trong tiểu não của chuột. Trong nghiên cứu hiện tại,  đông trùng hạ thảo  xử lý polypeptide có thể thúc đẩy sự biểu hiện của  Slc18a2  và do đó thúc đẩy quá trình tiết chất dẫn truyền thần kinh ở chuột để giảm chứng khó vận động và hành vi giống như trầm cảm, điều này có thể giúp cải thiện khả năng học tập và trí nhớ.

Phosphatidylinositol-3-kinase (PI3K)/Akt và mục tiêu của con đường rapamycin (mTOR) ở động vật có vú, một trong những con đường dẫn truyền tín hiệu nội bào quan trọng nhất, đóng vai trò quan trọng trong các quá trình phát triển, sống sót, tăng sinh và chết theo chương trình của tế bào cũng như trong sự hình thành mạch [ ]. Các thành viên gia đình PI3K là các kinase quan trọng của inositol và phosphatidylinositol cũng như các phân tử truyền tín hiệu quan trọng, tham gia vào quá trình điều hòa tăng sinh tế bào, chết theo chương trình và quá trình biệt hóa [ ]. PIK3R5, một thành viên của họ PI3K, hiếm khi được nghiên cứu và chưa có nghiên cứu nào liên kết nó với hệ thần kinh [ ]. Trong nghiên cứu hiện tại, PCR định lượng thời gian thực đã chứng minh sự điều hòa giảm đáng kể của  Pik3r5  ( Tr.  = 0,0002353) với  đông trùng hạ thảo  xử lý polypeptide và kết quả thí nghiệm của nó có ý nghĩa hơn so với 2 gen còn lại. Biểu thức điều chỉnh giảm trong chip mRNA chỉ ra rằng  đông trùng hạ thảo  polypeptide có thể ức chế sự biểu hiện của gen, có thể được sử dụng như một mục tiêu thuốc tiềm năng của  đông trùng hạ thảo militaris  cho các nghiên cứu thử nghiệm tiếp theo.

5. Kết Luận

Một mô hình chuột về học tập và suy giảm trí nhớ đã được thiết lập thông qua việc tiêm scopolamine hydrobromide và tác dụng của các liều lượng khác nhau của  đông trùng hạ thảo  polypeptit được phân phối trong dạ dày đã được nghiên cứu bằng cách đánh giá hành vi của chuột thông qua thử nghiệm mê cung nước Morris, phép đo một số chỉ số sinh học trong huyết thanh và mô não của chuột, đồng thời xác định các gen biểu hiện khác nhau và các đường truyền tín hiệu tế bào liên quan. Kết quả cho thấy  đông trùng hạ thảo  polypeptide có thể cải thiện khả năng học tập và trí nhớ ở những con chuột này, tăng hoạt động SOD huyết thanh, giảm hàm lượng MDA huyết thanh, giảm hoạt động AChE, tăng hoạt động Na + -k + -ATPase và eNOS, đồng thời tăng mức GABA và Glu trong mô não của chuột những con chuột. Phân tích chip tệp biểu hiện mRNA, phân tích cụm chức năng gen theo cơ sở dữ liệu DAVID và xác minh qPCR thời gian thực cho thấy sự cải thiện trong học tập và trí nhớ do  đông trùng hạ thảo  điều trị bằng polypeptide trong mô hình suy giảm khả năng học tập và trí nhớ của chuột có khả năng liên quan đến tác dụng của nó đối với  Pik3r5 ,  Il-1β ,  và Slc18a2 và ba gen này có thể là mục tiêu tiềm năng cho  Đông trùng hạ thảo militaris .

Sự nhìn nhận

Công trình này được hỗ trợ tài chính bởi Trung tâm Nghiên cứu và Phát triển R&D của National and Local United Engineering về Active Peptide của Động vật và Thực vật làm thuốc ở vùng núi Trường Bạch, dự án Phát triển Khoa học và Công nghệ tỉnh Cát Lâm (201603095YY, 201603092YY, 20170307016YY), Cơ quan Khoa học và Công nghệ Thành phố Cát Lâm Dự án Phát triển và Đổi mới Công nghệ (20166017), Dự án Khoa học và Công nghệ Y học Trung Quốc tỉnh Cát Lâm (2017086), Dự án nghiên cứu của Sở Giáo dục tỉnh Cát Lâm (JJKH20170064KJ, JJKH20170065KJ), Nhóm Đổi mới Nghiên cứu và Phát triển Tài nguyên Động vật và Thực vật ở núi Trường Bạch thuộc Đại học Beihua , và Chương trình Khuyến khích Giáo viên Trẻ của Đại học Beihua (Đại học Beihua (2016) 43).

Xung đột lợi ích

Các tác giả tuyên bố rằng họ không có xung đột lợi ích.

Người giới thiệu

1.   Kempermann G. Các yếu tố quyết định di truyền của quá trình hình thành hồi hải mã ở người trưởng thành có tương quan với việc thu nhận, nhưng không phải là Hiệu suất Thử nghiệm, trong Mazetask nước.   Tạp chí khoa học thần kinh châu Âu . 2002; 16 (1):129–136.  [ PubMed ]   [ ]
2.   van Praag H., Shubert T., Zhao C., Gage FH Tập thể dục tăng cường khả năng học tập và phát sinh thần kinh hồi hải mã ở chuột già.   Tạp chí Khoa học thần kinh . 2005; 25 (38):8680–8685. doi: 10.1523/JNEUROSCI.1731-05.2005.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
3.   Snyder JS, Hong NS, McDonald RJ, Wojtowicz JM Vai trò đối với sự hình thành thần kinh của người trưởng thành trong trí nhớ dài hạn về không gian.   Khoa học thần kinh . 2005; 130 (4):843–852. doi: 10.1016/j.neuroscience.2004.10.009.  [ PubMed ] [ CrossRef ]   [ ]
4.   Meltzer LA, Yabaluri R., Deisseroth K. Vai trò của cân bằng nội môi mạch trong quá trình hình thành thần kinh ở người trưởng thành.   Xu hướng trong khoa học thần kinh . 2005; 28 (12):653–660. doi: 10.1016/j.tins.2005.09.007.  [ PubMed ] [ CrossRef ]   [ ]
5.   Kempermann G., Wiskott L., Gage FH Ý nghĩa chức năng của sự hình thành thần kinh trưởng thành.   Ý kiến ​​​​hiện tại về sinh học thần kinh . 2004; 14 (2):186–191. doi: 10.1016/j.conb.2004.03.001.  [ PubMed ] [ CrossRef ]   [ ]
6.   Song J., Wang Y., Liu C., et al. Chiết xuất thân quả Cordycepsmilitaris cải thiện viêm cầu thận màng bằng cách làm giảm căng thẳng oxy hóa và viêm thận thông qua con đường NF-kappaB.   Thực phẩm & Chức năng . 2006; 7 (4):2006–2015.  [ PubMed ]   [ ]
7.   Zhou GF, Liu QT, Zhou B., et al. Các tác động phân tử tiềm ẩn của bursal septpeptide II đối với hoạt động cảm ứng miễn dịch và chống ung thư.   Tạp chí Khoa học Thú y . 2015; 16 (3):325–331. doi: 10.4142/jvs.2015.16.3.325.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
số 8.   Kasus-Jacob A., Noor-Mohammadi S., Griffith GL, Hinsley H., Mathias L., Pereira HA Một peptide đa chức năng dựa trên phân tử bảo vệ miễn dịch bạch cầu trung tính, CAP37, có đặc tính kháng khuẩn và chữa lành vết thương.   Tạp chí Sinh học Bạch cầu . 2015; 97 (2):341–350. doi: 10.1189/jlb.3A0214-104RR.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
9.   Izgi K., Iskender B., Sakalar C., Arslanhan A., Saraymen B., Canatan H. Đánh giá hai chất bổ trợ khác nhau với peptide có nguồn gốc từ uroplakin 3A có khả năng gây miễn dịch ở chuột.   Mạng lưới Cytokine Châu Âu . 2015; 26 (2):46–56. doi: 10.1684/ecn.2015.0365.  [ PubMed ] [ CrossRef ]   [ ]
10.   Liu J.-Y., Feng C.-P., Li X., Chang M.-C., Meng J.-L., Xu L.-J. Hoạt động điều hòa miễn dịch và chống oxy hóa của Cordyceps militaris polysacarit ở chuột.   Tạp chí quốc tế về các đại phân tử sinh học . 2016; 86 :594–598. doi: 10.1016/j.ijbiomac.2016.02.009.  [ PubMed ] [ CrossRef ]   [ ]
11.   Song J., Wang Y., Teng M. Cordyceps militaris gây chết tế bào khối u thông qua con đường ty thể phụ thuộc vào caspase trong các tế bào HepG2 và MCF7.   Báo cáo y học phân tử . 2016; 13 (6):5132–5140. doi: 10.3892/mmr.2016.5175.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
12.   Avtonomova AV, Krasnopolskaya LM, Shuktueva MI, Isakova EB, Bukhman VM Đánh giá tác dụng chống khối u của quá trình nuôi cấy ngập nước của Ophiocordycepssinensis và Cordycepsmilitaris.   AntibiotKhimioter . 2016; 60 (7-8):14–17.  [ PubMed ]   [ ]
13.   Chiu CP, Liu SC, Tang CH, et al. Cerebrosides chống viêm từ Cordycepsmilitaris được nuôi cấy.   Tạp chí Hóa học Nông nghiệp và Thực phẩm . 2016; 64 (7):1540–1548.  [ PubMed ]   [ ]
14.   Jo WS, Choi YJ, Kim HJ, et al. Tác dụng chống viêm của nước chiết xuất từ.   Mycobiology . 2010; 38 (1):46–51. doi: 10.4489/MYCO.2010.38.1.046.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
15.   Xie L., An L., Du P., et al. Nghiên cứu công nghệ enzym phân giải peptide Cordyceps militaris và tác dụng của nó đối với chức năng miễn dịch ở chuột.   Y học sáng chế truyền thống Trung Quốc . 2016; 38 (9):2048–2050.   [ ]
16.   Dos Santos LF, Rubel R., Ribeiro Bonatto SJ, et al. Tác dụng của Cordyceps sinensis đối với chức năng đại thực bào ở chuột được cho ăn chế độ ăn nhiều chất béo và tác dụng chống tăng sinh của nó đối với các tế bào u nguyên bào thần kinh ở người IMR-32.   Tạp chí Dân tộc học . 2018; 214 :106–112.  [ PubMed ]   [ ]
17.   Wang D., Wang J., Wang D., et al. Tác dụng bảo vệ thần kinh của phần butanol của ve sầu Cordyceps đối với thiệt hại do glutamate gây ra trong các tế bào PC12 liên quan đến độc tính oxy hóa.   Tạp chí sắc ký. B, Công nghệ phân tích trong y sinh và khoa học đời sống . 2017; 1 :1061–1062.   [ ]
18.   Xie L., An L., Du P. Nghiên cứu phương pháp điều chế quá trình thủy phân enzyme của các peptit hoạt tính Cordyceps militaris.   Nghiên cứu Thuốc và Dược liệu Lishizhen . 2017; 28 (5):1123–1125.   [ ]
19.   Ye J., Fang L., Zheng H., et al. WEGO: một công cụ web để vẽ các chú thích GO.   Nghiên cứu axit nucleic . 2006; 34 :W293–W297. doi: 10.1093/nar/gkl031.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
20.   Rodriguez-Tomé P., Stoehr PJ, Cameron GN, Flores TP Cơ sở dữ liệu của Viện Tin sinh học Châu Âu (EBI).   Nghiên cứu axit nucleic . 1996; 24 (1):6–12. doi: 10.1093/nar/24.1.6.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
21.   Huang DW, Sherman BT, Tan Q., et al. Công cụ phân loại chức năng gen DAVID: một thuật toán mới lấy mô-đun sinh học làm trung tâm để phân tích chức năng các danh sách gen lớn.   Sinh học bộ gen . 2007; 8 (9, bài R183) doi: 10.1186/gb-2007-8-9-r183.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
22.   De Almeida ME, Koru O., Steurer F., Herwaldt BL, Da Silva AJ Phát hiện và phân biệt Leishmania spp. Trong các mẫu bệnh phẩm bằng cách sử dụng xét nghiệm PCR thời gian thực dựa trên màu xanh lá cây SYBR.   Tạp chí Vi sinh lâm sàng . 2017; 55 (1):281–290. doi: 10.1128/JCM.01764-16.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
23.   Shi Q., ​​Zhou W., Chen C., et al. Các tính năng của bệnh prion di truyền dựa trên chương trình giám sát của Trung Quốc.   XIN MỘT . 2015; 10 (10) doi: 10.1371/journal.pone.0139552. e0139552   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
24.   Zamanian M., Hajizadeh MR, Esmaeili Nadimi A., Shamsizadeh A., Allahtavakoli M. Tác dụng chống mệt mỏi của troxerutin đối với khả năng chịu đựng khi tập thể dục, stress oxy hóa và mức độ metallicoproteinase-9 ở chuột đực được huấn luyện.   Dược lý cơ bản & lâm sàng . 2017; 31 (4):447–455. doi: 10.1111/fcp.12280.  [ PubMed ] [ CrossRef ]   [ ]
25.   Deguil J., Ravasi L., Lamberty Y., et al. Sự phát triển ban đầu của các loại thuốc điều trị triệu chứng trong AD: Đánh giá có hệ thống về việc sử dụng các dấu ấn sinh học.   Rối loạn thần kinh trung ương và thần kinh - Mục tiêu của thuốc . 2016; 15 (7):823–836. doi: 10.2174/1871527315666160518124759.  [ PubMed ] [ CrossRef ]   [ ]
26.   Bocca C., Novo E., Miglietta A., Parola M. Angiogenesis và Fibrogenesis trong bệnh gan mãn tính.   Tế bào và phân tử Gastroenterology và Gan . 2015; 1 (5):477–488. doi: 10.1016/j.jcmgh.2015.06.011.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
27.   Gu M., Miyoshi K., Dubner R., et al. Kích hoạt thụ thể 5-HT3 cột sống gây ra quá mẫn hành vi thông qua một tầng tín hiệu thần kinh-thần kinh đệm-nơ-ron.   Tạp chí Khoa học thần kinh . 2011; 31 (36):12823–12836. doi: 10.1523/JNEUROSCI.1564-11.2011.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]   rút lại
28.   Xue F., Liu L., Fan J., et al. Interleukin-1 β  thúc đẩy sự hình thành thần kinh của các thể động mạch cảnh bằng cách kích thích hoạt hóa ERK1/2.   Sinh lý học hô hấp & Sinh học thần kinh . 2015; 219 :78–84. doi: 10.1016/j.resp.2015.08.008.  [ PubMed ] [ CrossRef ]   [ ]
29.   Thay đổi SP, Stout KA, Lohr KM, et al. Giảm vận chuyển monoamine trong mụn nước làm gián đoạn tín hiệu serotonin nhưng không gây thoái hóa serotonergic.   Thần kinh học thực nghiệm . 2016; 275 :17–24. doi: 10.1016/j.expneurol.2015.09.016.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]
30.   Cantley LC Con đường phosphoinositide 3-kinase.   khoa học . 2002; 296 (5573):1655–1657. doi: 10.1126/khoa hoc.296.5573.1655.  [ PubMed ] [ CrossRef ]   [ ]
31.   Nicholson KM, Anderson NG Con đường truyền tín hiệu protein kinase B/Akt trong bệnh ác tính ở người.   Tín hiệu di động . 2002; 14 (5):381–395. doi: 10.1016/s0898-6568(01)00271-6.  [ PubMed ] [ CrossRef ]   [ ]
32.   Thauvin-Robinet C., Auclair M., Duplomb L., et al. Đột biến PIK3R1 gây ra hội chứng kháng insulin kèm theo teo mỡ.   Tạp chí Di truyền học Người Mỹ . 2013; 93 (1):141–149. doi: 10.1016/j.ajhg.2013.05.019.   [ Bài viết miễn phí của PMC ]  [ PubMed ] [ CrossRef ]   [ ]

Leave a comment