Giảm Cân Với Đông Trùng Hạ Thảo

 2018; 17:276.
Xuất bản trực tuyến 2018 ngày 6 tháng 12. doi: 10.1186/s12944-018-0910-6
PMCID: PMC6284310
PMI: 30522511

Cordycepin làm giảm cân thông qua việc điều chỉnh hệ vi sinh vật đường ruột ở chuột béo phì do chế độ ăn nhiều chất béo

trừu tượng

Lý lịch

Ngày càng có nhiều nghiên cứu chỉ ra rằng béo phì là tác nhân chính gây ra các bệnh tim mạch, bệnh gan nhiễm mỡ không do rượu, bệnh tiểu đường loại 2 và một số loại ung thư và sự thay đổi hệ vi sinh vật đường ruột là một trong những nguyên nhân dẫn đến béo phì. Hiện tại, hệ vi sinh vật đường ruột ngày càng được chú ý như một cơ quan chuyển hóa năng lượng tiềm năng. Nghiên cứu gần đây của chúng tôi đã báo cáo rằng cordycepin, một thành phần hoạt tính sinh học chính được tách ra từ Cordyceps militaris, ngăn ngừa tăng cân ở những con chuột được cho ăn chế độ ăn nhiều chất béo tác động trực tiếp lên tế bào mỡ, tuy nhiên, tác dụng của cordycepin điều chỉnh hệ vi sinh vật đường ruột vẫn chưa được biết rõ.

phương pháp

Trong nghiên cứu này, chúng tôi đã tổng hợp cordycepin (3-deoxyadenosine) bằng phương pháp hóa học và xác minh rằng cordycepin làm giảm sự tăng trọng lượng cơ thể và sự tích tụ chất béo xung quanh mào tinh và thận của những con chuột được cho ăn chế độ ăn nhiều chất béo. Hơn nữa, chúng tôi đã sử dụng giải trình tự thông lượng cao trên nền tảng MiSeq Illumina để kiểm tra các loài vi khuẩn đường ruột ở chuột béo phì do chế độ ăn nhiều chất béo.

Kết quả

Chúng tôi phát hiện ra rằng cordycepin điều chỉnh sự phong phú tương đối của vi khuẩn đường ruột ở những con chuột béo phì do chế độ ăn nhiều chất béo. Tuy nhiên, cordycepin không làm thay đổi sự đa dạng của vi khuẩn trong ruột. Điều trị bằng Cordycepin đã đảo ngược đáng kể sự phong phú tương đối của hai ngành vi khuẩn chiếm ưu thế (Bacteroidetes và Firmicutes) ở những con chuột béo phì do chế độ ăn nhiều chất béo gây ra, dẫn đến sự phong phú tương tự như ở nhóm ăn kiêng chow.

Phần kết luận

Nghiên cứu của chúng tôi cho thấy rằng cordycepin có thể làm giảm trọng lượng cơ thể và hệ vi sinh vật do cordycepin tạo ra dường như là một kết quả trong số các cơ chế giảm béo phì của nó.

từ khóa: Cordycepin, Hệ vi sinh vật đường ruột, Béo phì, Trọng lượng cơ thể, Chất béo

Lý lịch

Béo phì là một vấn đề quan trọng đối với sức khỏe cộng đồng và ngày càng thu hút sự quan tâm của công chúng trên toàn thế giới. Béo phì có thể gây ra nhiều loại bệnh, chẳng hạn như bệnh tiểu đường loại 2 [ ], bệnh gan nhiễm mỡ không do rượu, bệnh hệ tim mạch, kháng insulin, ngưng thở khi ngủ, viêm xương khớp, ung thư, hen suyễn và bệnh túi mật [ ,  ]. WHO đã báo cáo rằng 3,4 triệu người trưởng thành chết vì béo phì hoặc thừa cân. Béo phì chủ yếu do nạp quá nhiều năng lượng và lối sống ít vận động [ ], gây mất cân bằng chuyển hóa năng lượng do giảm tiêu hao năng lượng, dẫn đến tích tụ lipid ở các mô khác nhau [ ]. Do đó, điều đặc biệt quan trọng là bảo vệ mọi người khỏi bệnh béo phì. Người ta đã báo cáo rằng béo phì có liên quan chặt chẽ với tình trạng viêm mãn tính, cấp độ thấp và sự thay đổi hệ vi khuẩn đường ruột. Ngoài ra, các đối tượng béo phì có biểu hiện viêm mãn tính, toàn thân và nồng độ nội độc tố trong huyết thanh cao (lipopolysacarit) có liên quan đến rối loạn chức năng hàng rào ruột [ ]. Cho đến nay, nhiều cơ chế khác nhau được báo cáo là có liên quan đến bệnh béo phì, bao gồm những thay đổi trong hoạt động vận động, thèm ăn thông qua tuyến yên hoặc vùng dưới đồi trong não, sinh nhiệt thông qua mô mỡ màu nâu và quá trình tạo mỡ trong mô mỡ trắng, vân vân [ ]. Đặc biệt, ngày càng có nhiều bằng chứng chỉ ra rằng sự thay đổi thành phần hệ vi sinh vật đường ruột có liên quan đến bệnh béo phì và các bệnh liên quan đến chuyển hóa [ ,  ]. Hệ thực vật đường ruột được tạo thành từ nhiều vi khuẩn góp phần nuôi dưỡng và điều hòa năng lượng [ ].

Có hàng triệu vi khuẩn trong ruột vật chủ, chẳng hạn như vi khuẩn, sinh vật nhân chuẩn và vi khuẩn cổ, trong đó vi khuẩn chiếm ưu thế nhất. Đại tràng là phần cuối cùng của hệ thống tiêu hóa và chứa đầy vi khuẩn đường ruột; nồng độ vi khuẩn xấp xỉ 109–1012 CFU/mL, chứa ít nhất 1000 loài khác nhau [ ]. Trong ruột người trưởng thành, khoảng 90% các loài vi khuẩn là từ ngành Firmicutes và Bacteroidetes phyla [ ]. Ngành Firmicutes chứa vi khuẩn gram dương từ hơn 200 chi khác nhau, bao gồm Clostridium, Catenibacterium, Eubacterium, Lactobacillus, Faecalibacterium, Ruminococcus, Roseburia, Dorea và Veillonella [ ]. Ngành Bacteroidetes, chứa khoảng 20 chi vi khuẩn gram âm, chẳng hạn như Bacteroides, Prevotella, Tannerella và Odoribacter, là ngành vi khuẩn phổ biến thứ hai. Các loại vi khuẩn ít phong phú nhưng phổ biến khác của hệ vi khuẩn đường ruột bao gồm Actinobacteria, Verrucomicrobia và Proteobacteria [ ]. Hệ vi sinh vật đường ruột đóng vai trò quan trọng trong sinh lý học và trao đổi chất [ ] bằng cách chiết xuất năng lượng từ các hợp chất khó tiêu trong chế độ ăn uống, làm trung gian miễn dịch và tổng hợp vitamin. Tuy nhiên, ngày càng có nhiều nghiên cứu chỉ ra rằng sự thay đổi của hệ vi sinh vật đường ruột có liên quan mật thiết đến nhiều loại bệnh. Những thay đổi bất thường trong hệ vi khuẩn đường ruột thường ảnh hưởng đến sức khỏe của vật chủ bằng cách gây ra phản ứng miễn dịch [ ,  ]. Thật thú vị, nhiều nghiên cứu đã chứng minh vai trò của vi khuẩn đường ruột đối với bệnh béo phì và rối loạn chức năng trao đổi chất. Trên thực tế, một số nhà nghiên cứu đã chứng minh mối quan hệ giữa hệ vi sinh vật đường ruột và sự phong phú của hai ngành vi khuẩn, Bacteroidetes và Firmicutes [ ]. Bằng chứng đầu tiên về sự thay đổi thành phần hệ vi sinh vật đường ruột để đáp ứng với kiểu hình béo phì đã được thể hiện ở những con chuột bị béo phì do di truyền; những con chuột này hiển thị ít Bacteroidetes hơn và nhiều vi khuẩn Firmicutes hơn [ ]. Ý tưởng về một quần thể vi sinh vật đường ruột gây béo phì xuất hiện khi cùng các tác giả phát hiện ra rằng kiểu hình béo phì có thể được truyền qua việc cấy ghép hệ vi sinh vật đường ruột ở chuột [ ]. Sự gia tăng Firmicutes có liên quan đến sự gia tăng các enzym có thể phân hủy polysacarit từ thực phẩm và tạo ra axit béo chuỗi ngắn (SCFA) [ ].

Đã có báo cáo rằng butyrate và propionate có thể chống béo phì và axetat chủ yếu gây béo phì. Trong khi butyrate chủ yếu được sản xuất bởi Firmicutes (quan trọng nhất thuộc nhóm Clostridium IV và XIVa, bao gồm Eubacterium trực tràng, Faecalibacterium prausnitzii và Rosuberia gutis) và đóng vai trò quan trọng trong việc duy trì sức khỏe đường ruột của vật chủ [ ], thì axetat và propionate chủ yếu được sản xuất bởi ngành Bacteroidetes [ ,  ,  ]. Hệ vi sinh vật đường ruột là một mục tiêu điều trị tiềm năng cho các bệnh chuyển hóa. Mặc dù can thiệp chế độ ăn uống có thể bình thường hóa thành phần của hệ vi sinh vật đường ruột ở những đối tượng thừa cân và béo phì, nhưng cần có nhiều phương pháp tiếp cận mục tiêu hơn [ ].

Cordycepin (CCS), cụ thể là 3-deoxyadenosine, là một thành phần hoạt tính sinh học chính được tách ra từ Cordyceps militaris. Thông tin tích lũy đã chỉ ra rằng cordycepin sở hữu nhiều chức năng sinh học, chẳng hạn như kháng vi-rút, chống viêm, chống oxy hóa, chống khối u, hỗ trợ quá trình chết theo chương trình, hoạt động chống huyết khối [ ,  ]. Những người khác và các nghiên cứu gần đây của chúng tôi đã chứng minh rằng cordycepin, một thành phần hoạt tính sinh học chính được tách ra từ C. militaris , ngăn ngừa tăng trọng lượng cơ thể ở những con chuột được cho ăn chế độ ăn nhiều chất béo (HFD) [ ,  ]. Và chúng tôi còn phát hiện ra rằng cordycepin điều chỉnh trọng lượng cơ thể bằng cách giảm prolactin thông qua thụ thể adenosine A1 [ ], hoặc điều trị bằng cordyceptin ảnh hưởng đến sự biệt hóa tiền tế bào mỡ, sự phát triển và thoái hóa của tế bào mỡ trong ống nghiệm và trong cơ thể (dữ liệu chưa được công bố của chúng tôi). Tuy nhiên, không có dữ liệu nào cho thấy cordycepin làm giảm béo phì bằng cách điều chỉnh hệ vi sinh vật đường ruột. Trong nghiên cứu này, chúng tôi đã chứng minh rằng cordycepin có thể làm giảm béo phì do chế độ ăn nhiều chất béo gây ra bằng cách điều chỉnh hệ vi sinh vật đường ruột.

phương pháp

Thí nghiệm trên động vật

Tất cả các thí nghiệm trên động vật được thực hiện theo Ủy ban đạo đức nghiên cứu và phúc lợi động vật tại Đại học Cát Lâm (số IZ-2009-008). Các giao thức đã được xem xét và phê duyệt bởi ủy ban. Chuột SD đực có trọng lượng cơ thể ban đầu là 180 ± 20 g được mua từ Trung tâm Động vật Thực nghiệm của Đại học Cát Lâm trong nghiên cứu này. Tất cả các nỗ lực đã được thực hiện để giảm tác hại cho chuột. Nhiệt độ là 25 ± 1 °C và độ ẩm tương đối là 40–80%. Cả chế độ ăn giàu chất béo (60% kcal, D12492) và chế độ ăn chow bình thường cho chuột (10% Kcal, D12450K) đều được cung cấp bởi Research Diets of the USA. Cordycepin (độ tinh khiết > 99%) được cung cấp bởi Học viện Đại học Thanh Hoa, Thâm Quyến Trung Quốc.

Sau bảy ngày thích nghi, 30 con chuột được chia ngẫu nhiên thành ba nhóm dựa trên trọng lượng cơ thể của chúng, không có sự khác biệt đáng kể giữa ba nhóm: (1) nhóm được cho ăn chế độ ăn bình thường (NFD) ( n = 10); (2) nhóm được cho ăn chế độ ăn nhiều chất béo (HFD) 60% ( n = 10); và (3) nhóm HFD + CCS (n = 10), sử dụng cordycepin (50 mg/kg) bằng ống hút mỗi ngày một lần trong 4 tuần đồng thời với chế độ ăn giàu chất béo 60%. Cordycepin được hòa tan trong nước cất trước khi tiêm vào dạ dày. Những con chuột trong nhóm NFD và nhóm HFD được cung cấp cùng một lượng nước cất, giống hệt như nhóm được điều trị bằng cordycepin.

Trong quá trình thí nghiệm, khối lượng cơ thể được theo dõi hàng tuần và liều lượng sử dụng được điều chỉnh cho phù hợp. Cuối cùng, khối lượng cơ thể lúc đói được đo chính xác sau 12 giờ không có thức ăn, và sau đó, tất cả chuột đều bị chết. Các mô, bao gồm mỡ quanh thận và mỡ ngoài mào tinh hoàn, được cắt bỏ và cân. Chỉ số mỡ sau đó được tính theo công thức sau [ ]: (trọng lượng mỡ mào tinh + trọng lượng mỡ quanh thận) × 100/trọng lượng cơ thể. Ngoài ra, nội dung của ruột được thu thập trong điều kiện vô trùng và ngay lập tức được đông lạnh trong nitơ lỏng để giải trình tự 16S rDNA.

Giải trình tự các vùng 16S rDNA V3 và V4 của hệ vi sinh vật đường ruột

Một bộ DNA bộ gen Micro Elute (D3096–01, Omega, Inc., USA) đã được sử dụng để trích xuất tổng số DNA bộ gen từ hệ vi sinh vật đường ruột. Phương pháp chiết xuất cụ thể được thực hiện theo hướng dẫn của nhà sản xuất. Sau đó, các vùng biến đổi kép 16S rDNA V3 và V4 từ mỗi mẫu được khuếch đại thông qua phản ứng chuỗi polymerase (PCR) với Đoạn mồi 319F (ACTCCTACGGGAGGCAGCAG) và 806R (GGACTACHVGGGTWTCTAAT); vùng này (V3-V4) được sử dụng cho PCR vì có sự đa dạng lớn giữa các vi khuẩn trong ngành. Quá trình khuếch đại được thực hiện với mẫu DNA (50 ng) trong hệ thống 25 μL trong 25 chu kỳ3535 với Phusion DNA Polymerase. Việc trích xuất tổng số DNA bộ gen từ hệ vi sinh vật đường ruột và khuếch đại quá trình tạo pyro xa đã được thực hiện trên nền tảng Illumina MiSeq tại Công ty Công nghệ LC-Bio, Hàng Châu, tỉnh Chiết Giang, Trung Quốc.

tin sinh học

Dữ liệu Illumina MiSeq chồng chéo, 2 × 300 bp, được hợp nhất và ghép vào các thẻ. Sau đó, các thẻ được lọc bởi bộ lọc chất lượng QIIME (Thông tin chi tiết định lượng về hệ sinh thái vi sinh vật). Nói một cách đơn giản, mỗi lần đọc được tính là dữ liệu hiệu quả sẽ được bảo lưu và những lần đọc không đáp ứng tất cả các yêu cầu sẽ bị loại khỏi phân tích tiếp theo.

Sau đó, các trình tự được nhóm thành các đơn vị phân loại vận hành (OTU) với độ tương tự 97%. Về cơ bản, có ít hơn 3% sự khác biệt về trình tự trong tất cả các lần đọc của cùng một OTU. RPD (Dự án cơ sở dữ liệu Ribosom) đã được áp dụng để phân loại trình tự OTU và xác định các loài vi khuẩn.

Phân tích thống kê

Tất cả các phân tích dữ liệu trong nghiên cứu này đều tuân theo ANOVA một chiều bằng SPSS Statistic 19.0 (IBM, Hoa Kỳ). Sự khác biệt ít hơn 5% giữa các phương tiện cá nhân được coi là đáng kể.

Kết quả

Thiết kế và tổng hợp cordycepin

Trong nghiên cứu của chúng tôi, cordycepin được tổng hợp bằng phương pháp hóa học. Adenosine, không đắt tiền, đã được sử dụng làm nguyên liệu ban đầu và sau đó được thay thế có chọn lọc bởi Mattock's bromide để brom hóa các nhóm 3′ hydroxyl của adenosine, tiếp theo là thủy phân để thu được 3′ bromo adenosine. Cuối cùng, quá trình khử brom bằng quá trình hydro hóa có xúc tác đã được thực hiện để thu được sản phẩm mục tiêu, cordycepin. Con đường tổng hợp và cấu trúc hóa học của cordycepin được thể hiện trong (Hình 1 ).

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is 12944_2018_910_Fig1_HTML.jpg

Con đường tổng hợp và cấu trúc hóa học của cordycepin. (I) Đông Trùng Hạ Thảo. (II, III, IV) sản phẩm trung gian

Cordycepin làm giảm trọng lượng cơ thể và chất béo ở chuột béo phì do chế độ ăn nhiều chất béo

Để nghiên cứu ảnh hưởng của cordycepin đối với trọng lượng cơ thể và chất béo, chúng tôi đã thiết lập mô hình chuột béo phì bằng cách cho chuột ăn chế độ ăn nhiều chất béo. Cordycepin (50 mg/kg/ngày) được dùng bằng đường uống khi bắt đầu chế độ ăn nhiều chất béo trong 4 tuần. Kết quả của chúng tôi cho thấy bệnh béo phì được gây ra đáng kể từ tuần thứ 2 đến tuần thứ 4 ở những con chuột được cho ăn chế độ ăn nhiều chất béo (Hình 2 a). Cordycepin làm giảm đáng kể sự gia tăng trọng lượng cơ thể này ở những con chuột béo phì do chế độ ăn nhiều chất béo ( P <0,01) (Hình. ​(Hình.2a) 2 a) và ức chế sự tích tụ mỡ trong cơ thể so với nhóm HFD từ tuần thứ 2 đến tuần thứ 4 ( P < 0,01) (Hình. (Hình.2b). 2 b). Nói chung, cordycepin có thể làm giảm trọng lượng cơ thể và chất béo ở những con chuột béo phì do chế độ ăn nhiều chất béo.

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is 12944_2018_910_Fig2_HTML.jpg

Tác dụng chống béo phì của cordycepin ở chuột béo phì do chế độ ăn nhiều chất béo. ( a ) Trọng lượng cơ thể. ( b ) Chỉ số mỡ, được tính theo công thức sau: 100 × (trọng lượng mỡ mào tinh + trọng lượng mỡ quanh thận)/trọng lượng cơ thể. Sự khác biệt được đánh giá bằng ANOVA một chiều, (* P <0,05, ** P <0,01, *** P <0,001). NFD có nghĩa là những con chuột được cho ăn theo chế độ bình thường; HFD có nghĩa là những con chuột được cho ăn chế độ ăn nhiều chất béo; CCS có nghĩa là chuột được cho ăn chế độ giàu chất béo và uống cordycepin (50 mg/kg) trong 4 tuần liên tục

Thay đổi cấu trúc hệ vi sinh vật đường ruột bằng cordycepin ở chuột béo phì do chế độ ăn nhiều chất béo

Để thử nghiệm tác dụng của cordycepin đối với việc điều chỉnh cấu trúc hệ vi sinh vật đường ruột, quá trình pyro xa thông lượng cao đã được thực hiện với nền tảng Illumina MiSeq để tạo ra 820.838 trình tự hợp lệ và chất lượng cao từ 9 mẫu nội dung đường ruột từ các nhóm khác nhau. Nhóm NFD tạo ra 73.056 ± 20540 trình tự trên mỗi mẫu, nhóm HFD tạo ra 92.682 ± 23654 trình tự trên mỗi mẫu và nhóm CCS tạo ra 107.874 ± 5608 trình tự trên mỗi mẫu. Các trình tự chất lượng cao được chỉ định vào 3303 đơn vị phân loại vận hành (OTU) với độ tương tự 97%. Chúng tôi thấy rằng mặc dù có thể thu được các loài mới bằng cách tăng trình tự, nhưng hầu hết sự đa dạng của hệ vi sinh vật đường ruột có thể thu được với độ sâu trình tự hiện tại bằng phân tích Shannon và Rarefaction (Hình 3 a, b). Chỉ số đa dạng của Shannon và các ước tính OTU hiếm gặp được tính toán bằng cách làm giảm độ sâu trình tự trong số tất cả các mẫu bằng ứng dụng trợ giúp. Không có sự khác biệt đáng kể về sự phong phú và đa dạng của loài bằng cách phân tích các chỉ số Shannon, Simpson và Chao1 giữa các nhóm NFD, HFD và CCS.

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is 12944_2018_910_Fig3_HTML.jpg

Sự đa dạng và phong phú của hệ vi sinh vật đường ruột ở chuột. ( a ) Hiển thị các đường cong hiếm gặp của các mẫu từ nhóm NFD, nhóm HFD và nhóm CCS. ( b ) Hiển thị chỉ số Shannon của các mẫu từ nhóm NFD, nhóm HFD và nhóm CCS. ( c ) Âm mưu PCoA. Biểu đồ phân tích thành phần chính (PCA) cho điểm hệ vi sinh vật đường ruột dựa trên sự phong phú tương đối của OTU. ( d ) Phân tích cụm, bảng uniFrac-OTU không trọng số. NFD có nghĩa là những con chuột được cho ăn theo chế độ bình thường ( n = 3), HFD có nghĩa là những con chuột được cho ăn theo chế độ nhiều chất béo ( n = 3), và CCS có nghĩa là những con chuột được cho ăn theo chế độ nhiều chất béo và được bổ sung cordycepin (50 mg/ kg) ( n = 3) trong 4 tuần liên tục

Phân tích tọa độ chính dựa trên UniFrac (PCoA) cho thấy sự phân cụm rõ ràng về thành phần hệ vi sinh vật đường ruột cho từng nhóm được điều trị. Phân tích đa biến về phương sai của điểm số ma trận PCoA cho thấy sự phân tách có ý nghĩa thống kê giữa hệ vi sinh vật của nhóm NFD, nhóm HFD và nhóm CCS (Hình 2). (Hình.3c). 3c ). Tuy nhiên, khi các nhóm cordycepin, NFD và HFD được so sánh, người ta thấy có sự khác biệt đáng kể (Hình. ​(Hình 3 3 d).

Đáng chú ý là phân loại loài đã chứng minh rằng thành phần hệ vi sinh vật đường ruột đã thay đổi đáng kể ở những con chuột béo phì do chế độ ăn nhiều chất béo bằng cách sử dụng cordycepin trong 4 tuần. Tổng cộng có 13 ngành vi khuẩn đã được phát hiện bằng trình tự 16S rDNA: Firmicutes, Bacteroidetes, Proteobacteria, Cyanobacteria, Spirochaetes, Tenericutes, Deferribacteres, vi khuẩn Candidatus Sacchari, Actinobacteria, Elusimicrobia, Verrucomicrobia, Fusobacteria và Lentisphaerae. Trong số các ngành này, Firmicutes, Bacteroidetes và Proteobacteria chiếm 98% tổng số và tỷ lệ phần trăm của tất cả các ngành khác là 2%.

Hệ vi sinh vật đường ruột được phân tích bằng phương pháp pyro xa 16S rDNA ở các cấp độ ngành, lớp, bộ, họ, chi và loài (Hình 4 ). Ở cấp độ của ngành, so với nhóm NFD, nhóm HFD đã giảm đáng kể trong ngành Bacteroidetes và có khả năng tăng đáng kể trong ngành Firmicutes. Tuy nhiên, so với nhóm HFD, việc điều trị bằng cordycepin làm giảm ngành Firmicutes và tăng ngành Bacteroidetes ở những con chuột béo phì do chế độ ăn nhiều chất béo; những thay đổi này đã khôi phục lại mức độ của nhóm được cho ăn theo chế độ bình thường. Tuy nhiên, không có sự khác biệt đáng kể về mức độ Proteobacteria giữa ba nhóm (Hình. ​(Hình 4 4 a).

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is 12944_2018_910_Fig4_HTML.jpg

Phân tích thành phần của hệ vi sinh vật đường ruột ở các cấp phân loại khác nhau trong số tất cả các mẫu. ( a ) Ngành. ( b ) Lớp học. ( c ) Đặt hàng. ( d ) Gia đình. ( e ) Chi. ( f ) Loài. Chỉ 20 OTU nhiều nhất được hiển thị. NFD có nghĩa là những con chuột được cho ăn theo chế độ bình thường ( n = 3), HFD có nghĩa là những con chuột được cho ăn theo chế độ nhiều chất béo ( n = 3), và CCS có nghĩa là những con chuột được cho ăn theo chế độ nhiều chất béo và được uống cordycepin (50 mg) /kg) ( n = 3) liên tục trong 4 tuần

Ở cấp độ phân loại, những con chuột trong nhóm HFD thể hiện mức độ Clostridia cao hơn đáng kể, (một loại của Firmicutes phylum) cũng như giảm đáng kể Bacterodia (một loại Bacteroidetes phylum); tỷ lệ phần trăm của hai nhóm vi khuẩn trong nhóm được điều trị bằng cordycepin đã trở lại mức của nhóm NFD (nhóm NFD làm tài liệu tham khảo) (Hình. ​(Hình 4 4 b).

Ở cấp độ trật tự, so với nhóm NFD, nhóm HFD cho thấy Bacteroidales (một bộ của Bacterodiaclass, Bacteroidetes phylum) và Lactobacillales (một bộ của Bacillales, Firmicutes phylum) giảm đáng kể, trong khi Pasteurellales (một bộ của Bacillales, Firmicutes phylum) lớp Gamma proteobacteria, Proteobacteria phylum), Bacillales (một bộ của Bacilli, Firmicutes phylum) và Clostridiales (một bộ của Clostridia, Firmicutes phylum) đã tăng lên đáng kể. Những thay đổi trên đã được cordycepin hoàn nguyên về mức tương tự như của nhóm NFD (nhóm NFD làm tài liệu tham khảo) (Hình. ​(Hình 4 4 c).

Ở cấp độ gia đình, những con chuột trong nhóm HFD thể hiện mức độ cao hơn đáng kể của Veillonellaceae, Lachnospiraceae (một họ thuộc bộ Clostridiales, lớp Clostridia, Firmicutes phylum) và Pasteurellaceae (một họ thuộc bộ Pasteurellales, lớp Gammaproteobacteria, Proteobacteria phylum) và cấp thấp hơn là Lactobacillaceae (một họ thuộc bộ Lactobacillales, lớp Bacilli, ngành Firmicutes), Spirochaetaceae (một họ thuộc bộ Spirochaetales, lớp Spirochaetes, Spirochaetes phylum), Eubacteriaceae (một họ thuộc bộ Clostridiales, lớp Clostridia, ngành Firmicutes ) và Prevotellaceae (một họ thuộc bộ Bacteroidales, lớp Bacterodia, Bacteroidetes phylum). Hơn nữa, cordycepin đã ngăn chặn những thay đổi này ở những con chuột béo phì do chế độ ăn nhiều chất béo gây ra ở mức độ tương tự như ở nhóm NFD (Hình. ​(Hình 4 4 d).

Ở cấp độ chi, so với nhóm NFD, Lactobacillus (một chi thuộc họ Lactobacillaceae, bộ Lactobacillales, lớp Bacilli, ngành Firmicutes), Clostridium XlVb (một chi thuộc họ Lachnospiraceae, bộ Clostridiales, lớp Clostridia, ngành Firmicutes) , Prevotella (một chi thuộc họ Prevotellaceae, bộ Bacteroidales, lớp Bacteroidia, ngành Bacteroidetes), Anaerovibrio (một chi thuộc họ Veillonellaceae, bộ Selenomonadales, lớp Negativicutes, Firmicutes phylum), Eubacterium (một chi thuộc họ Eubacteriaceae, bộ Clostridiales , lớp Clostridia, Firmicutes phylum), Parabacteroides (một chi thuộc họ Porphyromonadaceae, bộ Bacteroidales, lớp Bacterodia, Bacteroidetes phylum) đã giảm đáng kể và Clostridium IV, Oscillospira (một chi thuộc họ Ruminococcaceae, bộ Clostridia, lớp Clostridia, Firmicutes phylum) đã được tăng lên đáng kể trong nhóm HFD. Ngoài ra, cordycepin làm giảm những thay đổi này ở những con chuột béo phì do chế độ ăn nhiều chất béo gây ra ở mức độ tương tự như ở nhóm NFD (Hình. ​(Hình 4 4 e).

Ở cấp độ loài, so với nhóm NFD, Butyric monas synergistica (một loài thuộc giống Butyric monas, họ Porphyromonadaceae, bộ Bacteroidales, lớp Bacterodia, Bacteroidetes phylum) và Ruminococcus flavefaciens (một loài thuộc giống Ruminococcus, họ Ruminococcaceae, Clostridiales bộ Clostridia, Firmicutes phylum) tăng đáng kể, trong khi Prevotellacopri (một loài thuộc chi Prevotella, họ Prevotellaceae, bộ Bacteroidales, lớp Bacteroidetes, Bacteroidetes phylum) lại giảm đáng kể. So với nhóm HFD, sự phân bố tương đối của ba loại vi khuẩn trong nhóm được điều trị bằng cordycepin đã được hoàn nguyên về mức tương tự như của nhóm NFD (Hình. ​(Hình 4 4 e).

Nói chung, kết quả của chúng tôi cho thấy rằng những con chuột trong nhóm HFD thể hiện mức độ Bacteroidetes phylum thấp hơn và mức độ Firmicutes phylum cao hơn so với những con trong nhóm ăn kiêng bình thường. Hơn nữa, cordycepin làm giảm tỷ lệ phần trăm của ngành Firmicutes và tăng tỷ lệ phần trăm của ngành Bacteroidetes ở những con chuột béo phì do chế độ ăn nhiều chất béo. Một số thay đổi trong ngành chủ yếu là phù hợp ở cấp độ hạ nguồn. Chẳng hạn, lớp Clostridia, bộ Bacillales, bộ Clostridiales, họ Veillonellaceae, họ Lachnospiraceae, chi Clostridium IV, chi Oscillospira và các loài Ruminococcus flavefaciens, tất cả đều thuộc họ Firmicutes phylum, đều tăng đáng kể trong nhóm HFD. Hơn nữa, lớp Bacterodia, bộ Bacteroidales, họ Prevotellaceae, chi Prevotella, chi Parabacteroides và các loài Prevotellacopri, tất cả đều thuộc ngành Bacteroidetes phylum, đã giảm đáng kể ở những con chuột béo phì. Tuy nhiên, có một số mâu thuẫn ở hạ lưu cấp độ của ngành. Ví dụ, bộ Lactobacillales, bộ Clostridium XlVb, họ Lactobacillaceae, họ Eubacteriaceae, chi Lactobacillus, chi Clostridium XlVb, chi Anaerovibrio và chi Eu bacterium, thuộc ngành Firmicutes, đã giảm đáng kể. Tuy nhiên, Butyric monas synergistica, thuộc ngành Bacteroidetes phylum, đã giảm đáng kể ở chuột thuộc nhóm HFD. Những thay đổi về mức độ phong phú tương đối của Firmicutes và Bacteroidetes ở cấp độ ngành và lớp có thể được nhìn thấy trong bản đồ nhiệt (Hình 5 a, b).

An external file that holds a picture, illustration, etc.<span class='notranslate'>
</span>Object name is 12944_2018_910_Fig5_HTML.jpg

Phân tích bản đồ nhiệt của hệ vi sinh vật đường ruột thay đổi từ các phương pháp điều trị khác nhau. ( a ) Ngành. ( b ) Lớp. Cường độ màu trong mỗi mẫu được chuẩn hóa để biểu thị tỷ lệ tương đối của nó trong ba nhóm. Một dải màu, từ xanh dương đến đỏ, biểu thị các giá trị tương đối của hệ vi sinh vật (0–4). NFD có nghĩa là những con chuột được cho ăn theo chế độ bình thường ( n = 3), HFD có nghĩa là những con chuột được cho ăn theo chế độ nhiều chất béo ( n = 3), và CCS có nghĩa là những con chuột được cho ăn theo chế độ giàu chất béo và được bổ sung cordycepin (50 mg/kg) ) ( n = 3) trong 4 tuần liên tục

Thảo luận

Các nghiên cứu trước đây đã báo cáo rằng cordycepin chiết xuất từ C. militaris có thể làm giảm sự tăng trọng lượng cơ thể ở chuột [ ], và kết quả gần đây của chúng tôi cho thấy rằng cordycepin điều chỉnh trọng lượng cơ thể bằng cách giảm prolactin thông qua thụ thể adenosine A1 [ ], hoặc cordyceptin điều chỉnh trọng lượng cơ thể bằng cách ức chế sự biệt hóa tiền tế bào mỡ và sự phát triển của tế bào mỡ, và gây ra thoái hóa tế bào mỡ (dữ liệu chưa được công bố của chúng tôi), những kết quả này cho thấy rằng cordycepin có thể tác động trực tiếp đến tế bào mỡ về mặt chuyển hóa lipid. Tuy nhiên, khả năng của cordycepin trong việc giảm tăng trọng lượng cơ thể bằng cách điều chỉnh sự phân bố của hệ vi sinh vật đường ruột ở những con chuột béo phì do chế độ ăn nhiều chất béo vẫn chưa được nghiên cứu. Trong nghiên cứu của chúng tôi, chúng tôi đã sử dụng adenosine để tổng hợp cordycepin bằng phương pháp hóa học và sau đó xác minh rằng cordycepin có tác dụng có lợi trong việc giảm cả trọng lượng cơ thể và sự tích tụ chất béo xung quanh mào tinh hoàn và thận, đồng thời chúng tôi phát hiện ra rằng cordycepin có thể điều chỉnh cấu trúc của hệ vi sinh vật đường ruột trong HFD -gây ra chuột béo phì.

Nhiều nghiên cứu trước đây đã chỉ ra rằng béo phì có liên quan mật thiết đến cấu trúc của hệ vi sinh vật đường ruột. Lượng Bacteroidetes cao hơn trong hệ vi sinh vật đường ruột có liên quan trực tiếp đến kiểu hình gầy [ ] và với những người béo phì giảm cân; các báo cáo ở cả chuột và người đã chứng minh rằng sự phong phú tương đối của Bacteroidetes bị giảm bởi chế độ ăn nhiều chất béo [ ]. Ngày càng có nhiều nhà nghiên cứu chứng minh rằng béo phì có liên quan đến những thay đổi về sự phong phú tương đối của Bacteroidetes và Firmicutes hoặc tỷ lệ giữa Bacteroidetes và Firmicutes. Nói chung, có sự gia tăng Firmicutes và giảm Bacteroidetes ở chuột và người béo phì [ ,  ]. Tương tự như vậy, kết quả của chúng tôi cho thấy rằng ngành Firmicutes đã tăng lên đáng kể và ngành Bacteroidetes đã giảm đáng kể ở những con chuột béo phì do chế độ ăn nhiều chất béo. Theo đó, việc sử dụng cordycepin đã ngăn ngừa béo phì do chế độ ăn kiêng và thay đổi sự phong phú tương đối của hệ vi sinh vật đường ruột ở những con chuột béo phì do chế độ ăn nhiều chất béo. Cụ thể, có ít Firmicutes phylum hơn và nhiều Bacteroidetes phylum hơn ở những con chuột béo phì do chế độ ăn nhiều chất béo gây ra được điều trị bằng cordycepin. Theo Turnbaugh và cộng sự, chế độ ăn ít năng lượng làm tăng tỷ lệ Bacteroidetes trong hệ vi sinh vật đường ruột [ ]. Ngược lại, có nhiều Firmicutes hơn ở những con chuột được cho ăn chế độ ăn nhiều chất béo [ ]. Những thay đổi về hệ vi sinh vật đường ruột có thể cần đến sự can thiệp của chế độ ăn uống [ ]. Việc cấy hệ vi sinh vật được thu hoạch từ những con chuột được nuôi thông thường sang những con chuột không có mầm bệnh dẫn đến tăng trọng lượng cơ thể và giảm độ nhạy insulin; thực tế này hỗ trợ thêm cho khái niệm rằng trọng lượng cơ thể có thể được điều chỉnh bởi hệ vi sinh vật đường ruột. Bất chấp những tranh cãi, các nghiên cứu luôn cho thấy sự gia tăng Firmicutes và giảm Bacteroidetes ở những con chuột béo phì. Tăng cường sự phong phú của Firmicutes trong hệ vi sinh vật đường ruột của bệnh nhân béo phì đã được đề xuất để tăng khả năng thu hoạch năng lượng từ chế độ ăn uống, do đó thúc đẩy sự hấp thụ calo hiệu quả hơn và tăng cân sau đó [ ]. Hơn nữa, so với Bacteroidetes, tỷ lệ Firmicutes cao hơn đã được mô tả ở những con chuột béo phì do di truyền hoặc do chế độ ăn kiêng. Sự gia tăng Firmicutes này có liên quan đến sự gia tăng các enzym có khả năng phân hủy các polysacarit khó tiêu hóa từ chế độ ăn uống và tạo ra các axit béo chuỗi ngắn (SCFA). Lactobacillus và Bifidobacterium thường được sử dụng làm men vi sinh [ ], và các nghiên cứu trước đây đã cho thấy sự gia tăng Lactobacillus và Bifidobacterium ở những người béo phì [ ,  ]. Tuy nhiên, Lecomte V et al. chỉ ra rằng sự phong phú của hai loài này có tương quan nghịch với khối lượng chất béo và trọng lượng cơ thể [ ]. Nghiên cứu của chúng tôi cho thấy ít Lactobacillus hơn ở chuột béo phì và Lactobacillus tăng đáng kể ở chuột được điều trị bằng cordycepin, tương tự như nhóm ăn kiêng bình thường. Trên thực tế, mối quan hệ giữa Lactobacillus và bệnh béo phì có thể phụ thuộc vào mô hình thí nghiệm hoặc loài Lactobacillus [ ]. Điều trị bằng Cordycepin cũng cho thấy tác động tích cực đến chi Prevotella (loài Prevotellacopri), là vi khuẩn đường ruột nổi tiếng. Do đó, cordycepin có thể điều chỉnh quá trình trao đổi chất tương đối bằng cách tăng men vi sinh. Tuy nhiên, chúng tôi thấy rằng Bifidobacterium không thay đổi giữa ba nhóm.

Đã có báo cáo rằng có sự gia tăng Oscillibacter spp. ở những con chuột được cho ăn chế độ ăn nhiều chất béo và những vi khuẩn này có mối liên hệ tiêu cực với sự biểu hiện của các protein liên kết chặt chẽ trong ruột [ ], tương tự như kết quả của chúng tôi. Trong nghiên cứu này, việc điều trị bằng cordycepin cho thấy sự sụt giảm đáng kể ở chi Oscillospira so với nhóm HFD, tương tự như đối với những con chuột được nuôi bằng thức ăn chow.

Vi khuẩn thuộc cụm Clostridium XIVa, XVIII và IV, thiếu các yếu tố độc lực và độc tố nổi bật, được phát hiện là điều chỉnh quá trình chuyển hóa axit béo của vật chủ, gây ra hoạt động của tế bào Treg và làm giảm viêm đại tràng [ ]. Hơn nữa, Eubacterium spp. gây ra bởi oligosacarit prebiotic tạo ra tác dụng có lợi trên vật chủ, làm nổi bật tác dụng sinh học tiềm năng của loài này. Kết quả của chúng tôi cho thấy rằng chi Eubacterium và Clostridium XlVb tăng đáng kể ở những con chuột được điều trị bằng cordycepin, tương tự như nhóm ăn kiêng chow. Nghiên cứu trước đây báo cáo rằng Eubacterium và Clostridium XlVb có thể tạo ra butyrate, có tác dụng chống béo phì [ ]. Những kết quả này chỉ ra rằng tác dụng của cordycepin đối với việc giảm tăng trọng lượng cơ thể và tích tụ chất béo có thể ít nhất một phần là do sự gia tăng dân số của những loài có lợi này. Ngoài ra, trong kết quả của chúng tôi, chúng tôi thấy rằng mầm bệnh Pasteurellaceae, thuộc Proteobacteria phylum [ ], tăng đáng kể ở nhóm HFD, trong khi Pasteurellaceae giảm đáng kể ở chuột được điều trị bằng cordycepin. Hơn nữa, có một mức độ thấp hơn của họ Spirochaetaceae (Spirochaetes phylum) ở những con chuột béo phì nhưng lại cao hơn ở những con chuột được điều trị bằng cordycepin.

Béo phì hàm ý sự mất cân bằng giữa năng lượng nạp vào và năng lượng tiêu hao, dẫn đến dư thừa năng lượng dự trữ dưới dạng mô mỡ. Hơn nữa, nhiều nghiên cứu cho thấy sự gia tăng trọng lượng cơ thể và chất béo ở chuột không có mầm bệnh sau khi cấy hệ vi sinh vật đường ruột có nguồn gốc từ chuột hoang dã cũng như từ chuột béo phì [ ,  ], và đây có thể là bằng chứng cho thấy hệ vi sinh vật đường ruột của những người béo phì lấy năng lượng từ chế độ ăn uống hiệu quả hơn so với hệ vi sinh vật của những người gầy. Và một số cơ chế liên quan đến hệ vi sinh vật đường ruột có thể giải thích cho việc tăng cân, chẳng hạn như quá trình lên men vi sinh vật của các polysacarit khó tiêu trong chế độ ăn uống thành các monosacarit có thể hấp thụ và tạo ra các axit béo chuỗi ngắn (SCFA) được chuyển đổi thành các chất béo phức tạp hơn trong gan, hơn nữa , Firmicutes là nhà sản xuất chính của butyrate SCFA [ ]. Kết quả của chúng tôi cho thấy sự gia tăng số lượng Firmicutes ở những con chuột béo phì do chế độ ăn nhiều chất béo gây ra, trong khi nhóm điều trị bằng cordycepin làm giảm đáng kể số lượng và tỷ lệ Firmicutes, phù hợp với các báo cáo trước đây.

Ngày càng có nhiều nghiên cứu chỉ ra rằng hệ vi sinh vật đường ruột có thể ảnh hưởng đến hoạt động và hành vi của não bộ. Ví dụ, một số nghiên cứu tiền lâm sàng đã chứng minh rằng việc thao túng hệ vi sinh vật đường ruột có thể thay đổi cảm xúc, cảm nhận về đêm và các hành vi xã hội [ ], đồng thời tạo ra những thay đổi về hóa chất thần kinh cụ thể theo vùng [ ]. Theo các báo cáo trước đây, hệ vi sinh vật đường ruột có liên quan đến những thay đổi trong cấu trúc vi mô não và sự tiết hormone ở bệnh béo phì, bằng cách tạo ra một số hợp chất hoạt động thần kinh bao gồm một số chất chuyển hóa có chứa dole và 5-HT, và các dấu hiệu não vi khuẩn khác biệt có thể phân biệt béo phì với béo phì. đối tượng nạc [ ,  ]. Từ đó, chúng ta có thể biết rằng hệ vi sinh vật đường ruột có liên quan đến việc tạo ra bệnh béo phì ở nhiều khía cạnh. Ngoài ra, trong kết quả của chúng tôi, cordycepin đã thay đổi sự phong phú tương đối của hệ vi sinh vật đường ruột (đặc biệt là ít hơn của ngành Firmicutes và nhiều hơn của ngành Bacteroidetes) ở những con chuột béo phì do chế độ ăn nhiều chất béo và làm cho nó giảm cân thành công. Tất cả các kết quả và bài báo này đã xác nhận rằng hệ vi sinh vật đường ruột có thể liên quan chặt chẽ đến lượng thức ăn ăn vào, cấu trúc vi mô não và bài tiết hormone.

Cùng với nhau, kết quả của chúng tôi cho thấy rằng cordycepin có ảnh hưởng trực tiếp đến hệ thống nội tiết và sự chuyển đổi giữa các chất béo, đặc biệt, ảnh hưởng của hệ vi khuẩn đường ruột đối với chất béo của cordycepin được tìm thấy trong nghiên cứu này cũng là một khía cạnh rất quan trọng. Tất cả những kết quả này mà chúng tôi tìm thấy chỉ ra rằng các cơ chế tác động của cordycepin lên chất béo có thể phức tạp và trung gian thông qua nhiều cơ chế, và các cơ chế này có thể đóng vai trò chéo đối với tác dụng giảm béo phì của cordycepin, tuy nhiên, mối quan hệ giữa những cơ chế này vẫn còn phải được nghiên cứu thêm.

kết luận

Tóm lại, nghiên cứu của chúng tôi cho thấy rằng việc điều chỉnh cấu trúc của hệ vi sinh vật đường ruột có thể là một trong những cơ chế giảm béo phì bằng cordycepin và những kết quả này cung cấp một cách tiềm năng để điều trị bệnh béo phì.

Sự nhìn nhận

Chúng tôi cảm ơn các giáo sư của trường đại học jilin về những phân tích số liệu.

Kinh phí

Công trình này được hỗ trợ bởi Ủy ban Khoa học, Công nghệ và Đổi mới của Thành phố Thâm Quyến (Số JSGG20160301100442775, JCYJ20160301100720906, GXZZ20140421112021913); Dự án Trọng điểm Nhà nước về Kế hoạch Nghiên cứu và Phát triển (2017YFD0502200; 2016YFD0501302); Quỹ Khoa học Tự nhiên Quốc gia Trung Quốc (Số 31172364); Quỹ Phát triển Khoa học & Công nghệ tỉnh Cát Lâm (20150101108JC); Dự án khoa học và công nghệ đặc thù quan trọng cấp quốc gia (2012ZX10003002); Chương trình dành cho những tài năng xuất sắc của thế kỷ mới trong trường đại học (NCET-09-0434); Dự án của Sở Giáo dục tỉnh Cát Lâm (Số 2016444).

Sự sẵn có của dữ liệu và tài liệu

Các bộ dữ liệu được sử dụng và phân tích trong nghiên cứu hiện tại có sẵn từ tác giả tương ứng theo yêu cầu hợp lý.

Các từ viết tắt

CCS đông trùng hạ thảo
HFD Cho ăn chế độ ăn giàu chất béo 60%
NFD Cho ăn một chế độ ăn uống bình thường
OTU Đơn vị phân loại hoạt động
PCoA Phân tích tọa độ chính dựa trên UniFrac
KIIME Những hiểu biết định lượng về hệ sinh thái vi sinh vật
SCFA Axit béo chuỗi ngắn

Tác giả đóng góp

LY và XT thiết kế nghiên cứu này; YL và YA đã thực hiện các thí nghiệm; YL và XW đã viết bản thảo; CW và LW đã thực hiện phân tích thống kê; SL, WL, XW và HX đưa ra các số liệu; ML và ZC hướng dẫn các thí nghiệm. Tất cả các tác giả đã đọc và phê duyệt bản thảo cuối cùng.

ghi chú

Phê duyệt đạo đức và đồng ý tham gia

Không áp dụng.

Đồng ý xuất bản

Tất cả các tác giả đọc và phê duyệt bản thảo cuối cùng.

Lợi ích cạnh tranh

Nhiều tác giả tuyên bố rằng họ không có hứng thú với việc cạnh tranh.

Ghi chú của nhà xuất bản

Springer Nature giữ thái độ trung lập đối với các tuyên bố về quyền tài phán trong các bản đồ đã xuất bản và các tổ chức liên kết.

Thông tin cộng tác viên

Từ Đông Đường, gro.zs-auhgnist@dxgnat .

Lục Vũ, nc.ude.ulj@ul_uy .

Người giới thiệu

1. Everard A, Belzer C, Geurts L, Ouwerkerk JP, Druart C, Bindels LB, Guiot Y, Derrien M, Muccioli GG, Delzenne NM, et al. Trao đổi chéo giữa Akkermansia muciniphila và biểu mô ruột kiểm soát bệnh béo phì do chế độ ăn kiêng. Proc Natl Acad Sci US A. 2013; 110 :9066–9071. doi: 10.1073/pnas.1219451110. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
2. Seidell JC, Halberstadt J. Gánh nặng béo phì toàn cầu và những thách thức trong phòng ngừa. Ann Nutr Metab. 2015; 66 (Bổ sung 2):7–12. doi: 10.1159/000375143. [ PubMed ] [ CrossRef ] [ ]
3. Cầni PD. Hệ vi sinh vật đường ruột và bệnh béo phì: bài học từ hệ vi sinh vật. Bộ gen chức năng ngắn gọn. 2013; 12 :381–387. doi: 10.1093/bfgp/elt014. [ PubMed ] [ CrossRef ] [ ]
4. Villanueva-Millan MJ, Perez-Matute P, Oteo JA. Hệ vi sinh vật đường ruột: nhân tố chính đối với sức khỏe và bệnh tật . Một đánh giá tập trung vào bệnh béo phì. J Hóa sinh vật lý. 2015; 71 :509–525. doi: 10.1007/s13105-015-0390-3. [ PubMed ] [ CrossRef ] [ ]
5. Seo DB, Jeong HW, Cho D, Lee BJ, Lee JH, Choi JY, Bae IH, Lee SJ. Chiết xuất trà xanh lên men làm giảm béo phì và các biến chứng liên quan, đồng thời thay đổi thành phần hệ vi sinh vật đường ruột ở chuột béo phì do chế độ ăn kiêng. Thực phẩm J Med. 2015; 18 :549–556. doi: 10.1089/jmf.2014.3265. [ PubMed ] [ CrossRef ] [ ]
6. Jiang T, Gao X, Wu C, Tian F, Lei Q, Bi J, Xie B, Wang HY, Chen S, Wang X. Pectin có nguồn gốc từ táo điều chỉnh hệ vi sinh vật đường ruột, cải thiện chức năng hàng rào ruột và làm giảm nội độc tố chuyển hóa ở chuột với béo phì do ăn kiêng. Chất dinh dưỡng. 2016; 8 :126. doi: 10.3390/nu8030126. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
7. Bjursell M, Gerdin AK, Lelliott CJ, Egecioglu E, Elmgren A, Tornell J, Oscarsson J, Bohlooly YM. Hoạt động vận động giảm mạnh là nguyên nhân chính gây ra bệnh béo phì do chế độ ăn kiêng ở phương Tây ở chuột. Am J Physiol Endocrinol Metab. 2008; 294 :E251–E260. doi: 10.1152/ajpendo.00401.2007. [ PubMed ] [ CrossRef ] [ ]
số 8. Oken E, Gillman MW. Nguồn gốc bào thai của bệnh béo phì. Obes Res. 2003; 11 :496–506. doi: 10.1038/oby.2003.69. [ PubMed ] [ CrossRef ] [ ]
9. Loh RKC, Kingwell BA, Carey AL. Mô mỡ màu nâu của con người là mục tiêu để quản lý bệnh béo phì; ngoài sự sinh nhiệt do lạnh gây ra. Obes Rev. 2017; 18 :1227–1242. doi: 10.1111/obr.12584. [ PubMed ] [ CrossRef ] [ ]
10. Vazquez-Vela TÔI, Torres N, Tovar AR. Mô mỡ trắng là cơ quan nội tiết và vai trò của nó đối với bệnh béo phì. Arch Med Res. 2008; 39 :715–728. doi: 10.1016/j.arcmed.2008.09.005. [ PubMed ] [ CrossRef ] [ ]
11. He X, Zheng N, He J, Liu C, Feng J, Jia W, Li H. Sự điều biến hệ vi sinh vật đường ruột làm suy giảm tác dụng Hạ lipid máu của simvastatin ở những con chuột được cho ăn nhiều chất béo/cholesterol. J Proteome Res. 2017; 16 :1900–1910. doi: 10.1021/acs.jproteome.6b00984. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
12. Liu X, Cao S, Zhang X. Điều chỉnh Trục vi sinh vật đường ruột-não bằng men vi sinh, prebiotic và Chế độ ăn kiêng. J Hóa chất Thực phẩm Nông nghiệp. 2015; 63 :7885–7895. doi: 10.1021/acs.jafc.5b02404. [ PubMed ] [ CrossRef ] [ ]
13. Chang CJ, Lin CS, Lu CC, Martel J, Ko YF, Ojcius DM, Tseng SF, Wu TR, Chen YY, Young JD, Lai HC. Nấm linh chi làm giảm béo phì ở chuột bằng cách điều chỉnh thành phần của hệ vi sinh vật đường ruột. xã Nat. 2015; 6 :7489. doi: 10.1038/ncomms8489. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
14. Brahe LK, Astrup A, Larsen LH. Chúng ta có thể ngăn ngừa các bệnh chuyển hóa liên quan đến béo phì bằng cách điều chỉnh chế độ ăn uống của hệ vi sinh vật đường ruột không? Adv Nutr. 2016; 7 :90–101. doi: 10.3945/an.115.010587. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
15. Dự án Hệ vi sinh vật của con người C Cấu trúc, chức năng và sự đa dạng của hệ vi sinh vật khỏe mạnh của con người. Thiên nhiên. 2012; 486 :207–214. doi: 10.1038/nature11234. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
16. Etxeberria U, Fernandez-Quintela A, Milagro FI, Aguirre L, Martinez JA, Portillo MP. Tác động của polyphenol và các nguồn thực phẩm giàu polyphenol đối với thành phần hệ vi sinh vật đường ruột. J Hóa chất Thực phẩm Nông nghiệp. 2013; 61 :9517–9533. doi: 10.1021/jf402506c. [ PubMed ] [ CrossRef ] [ ]
17. Huang H, Krishnan HB, Pham Q, Yu LL, Wang TT. Đậu nành và hệ vi sinh vật đường ruột: tương tác và ý nghĩa đối với sức khỏe con người. J Hóa chất Thực phẩm Nông nghiệp. 2016; 64 :8695–8709. doi: 10.1021/acs.jafc.6b03725. [ PubMed ] [ CrossRef ] [ ]
18. MV Machado, Cortez-Pinto H. Ăn kiêng, Microbiota, Béo phì và NAFLD: một bộ tứ nguy hiểm. Int J Mol Khoa học. 2016; 17 :481. doi: 10.3390/ijms17040481. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
19. Lecomte V, Kaakoush NO, Maloney CA, Raipuria M, Huinao KD, Mitchell HM, Morris MJ. Những thay đổi về hệ vi sinh vật đường ruột ở chuột được cho ăn chế độ ăn nhiều chất béo tương quan với các thông số trao đổi chất liên quan đến béo phì. XIN MỘT. 2015; 10 :e0126931. doi: 10.1371/journal.pone.0126931. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
20. Louis P, Flint HJ. Sự đa dạng, trao đổi chất và hệ sinh thái vi sinh vật của vi khuẩn sản xuất butyrate từ ruột già của con người. Giấy phép vi sinh vật FEMS. 2009; 294 :1–8. doi: 10.1111/j.1574-6968.2009.01514.x. [ PubMed ] [ CrossRef ] [ ]
21. Greenberg NA, Gassull MA, Meier R. Axit béo chuỗi ngắn: đã sẵn sàng cho thời điểm quan trọng? Phòng khám Nutr. 2006; 21 :639–640. doi: 10.1177/0115426506021006639. [ PubMed ] [ CrossRef ] [ ]
22. Everard A, Geurts L, Caesar R, Van Hul M, Matamoros S, Duparc T, Denis RG, Cochez P, Pierard F, Castel J, et al. Biểu mô ruột MyD88 là một cảm biến chuyển đổi chuyển hóa vật chủ theo hướng béo phì theo tình trạng dinh dưỡng. xã Nat. 2014; 5 :5648. doi: 10.1038/ncomms6648. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
23. Cotillard A, Kennedy SP, Kong LC, Prifti E, Pons N, Le Chatelier E, Almeida M, Quinquis B, Levenez F, Galleron N, et al. Can thiệp chế độ ăn uống tác động đến sự phong phú gen vi sinh vật đường ruột. Thiên nhiên. 2013; 500 :585–588. doi: 10.1038/nature12480. [ PubMed ] [ CrossRef ] [ ]
24. Wang F, Yin P, Lu Y, Zhou Z, Jiang C, Liu Y, Yu X. Cordycepin ngăn chặn sự ức chế quá trình tạo xương do stress oxy hóa gây ra. mục tiêu. 2015; 6 :35496–35508. [ Bài viết miễn phí của PMC ] [ PubMed ] [ ]
25. Takahashi S, Tamai M, Nakajima S, Kato H, Johno H, Nakamura T, Kitamura M. Ức chế sự biệt hóa tế bào mỡ bằng cordycepin. Dược phẩm Br J. 2012; 167 :561–575. doi: 10.1111/j.1476-5381.2012.02005.x. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
26. Li Y, Li Y, Wang X, Xu H, Wang C, An Y, Luan W, Wang X, Li S, Ma F, et al. Cordycepin điều chỉnh trọng lượng cơ thể bằng cách giảm prolactin thông qua thụ thể adenosine A1. Curr Pharm Des. 2018. [ PubMed ]
27. Kim SB, Ahn B, Kim M, Ji HJ, Shin SK, Hong IP, Kim CY, Hwang BY, Lee MK. Tác dụng của chiết xuất Cordyceps militaris và các thành phần hoạt động đối với các thông số trao đổi chất của bệnh béo phì do chế độ ăn nhiều chất béo gây ra ở chuột C58BL/6J. J Ethnopharmacol. 2014; 151 :478–484. doi: 10.1016/j.jep.2013.10.064. [ PubMed ] [ CrossRef ] [ ]
28. Zhang X, Zhao Y, Xu J, Xue Z, Zhang M, Pang X, Zhang X, Zhao L. Điều chế hệ vi sinh vật đường ruột bằng berberine và metformin trong quá trình điều trị bệnh béo phì do chế độ ăn nhiều chất béo ở chuột. Đại diện Khoa học 2015; 5 :14405. doi: 10.1038/srep14405. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
29. Evans CC, LePard KJ, Kwak JW, Stancukas MC, Laskowski S, Dougherty J, Moulton L, Glawe A, Wang Y, Leone V, et al. Tập thể dục ngăn ngừa tăng cân và thay đổi hệ vi sinh vật đường ruột trong mô hình chuột béo phì do chế độ ăn nhiều chất béo. XIN MỘT. 2014; 9 :e92193. doi: 10.1371/journal.pone.0092193. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
30. Angelakis E, Armougom F, Million M, Raoult D. Mối quan hệ giữa hệ vi sinh vật đường ruột và tăng cân ở người. Vi khuẩn tương lai. 2012; 7 :91–109. doi: 10.2217/fmb.11.142. [ PubMed ] [ CrossRef ] [ ]
31. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. Một hệ vi sinh vật đường ruột liên quan đến béo phì với khả năng thu hoạch năng lượng tăng lên. Thiên nhiên. 2006; 444 :1027–1031. doi: 10.1038/nature05414. [ PubMed ] [ CrossRef ] [ ]
32. Parnell JA, Reimer RA. Điều chế chất xơ prebiotic của hệ vi sinh vật đường ruột giúp cải thiện các yếu tố nguy cơ gây béo phì và hội chứng chuyển hóa. Vi khuẩn đường ruột. 2012; 3 :29–34. doi: 10.4161/gmic.19246. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
33. Tomas-Barberan FA, Mine Y. Chìa khóa để hiểu tác động của các hoạt chất sinh học trong thực phẩm đối với sức khỏe, hệ vi sinh vật đường ruột. J Hóa chất Thực phẩm Nông nghiệp. 2013; 61 :9755–9757. doi: 10.1021/jf404354f. [ PubMed ] [ CrossRef ] [ ]
34. Million M, Raoult D. Vai trò của việc điều khiển hệ vi sinh vật đường ruột đối với bệnh béo phì. Curr Infect Dis Rep. 2013; 15 :25–30. doi: 10.1007/s11908-012-0301-5. [ PubMed ] [ CrossRef ] [ ]
35. Shen F, Feng J, Wang X, Qi Z, Shi X, An Y, Zhang Q, Wang C, Liu M, Liu B, Yu L. Điều trị bằng giấm ngăn ngừa sự phát triển của viêm đại tràng thử nghiệm ở chuột thông qua ức chế viêm và quá trình chết theo chương trình. J Hóa chất Thực phẩm Nông nghiệp. 2016; 64 :1111–1121. doi: 10.1021/acs.jafc.5b05415. [ PubMed ] [ CrossRef ] [ ]
36. Bervoets L, Van Hoorenbeeck K, Kortleven I, Van Noten C, Hens N, Vael C, Goossens H, Desager KN, Vankerckhoven V. Sự khác biệt về thành phần hệ vi sinh vật đường ruột giữa trẻ béo phì và gầy: một nghiên cứu cắt ngang. Bệnh đường ruột. 2013; 5:10 . doi: 10.1186/1757-4749-5-10. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
37. Lam YY, Ha CW, Campbell CR, Mitchell AJ, Dinudom A, Oscarsson J, Cook DI, Hunt NH, Caterson ID, Holmes AJ, Storlien LH. Tăng tính thấm của ruột và thay đổi hệ vi sinh vật liên quan đến viêm mỡ mạc treo và rối loạn chức năng trao đổi chất ở chuột béo phì do ăn kiêng. XIN MỘT. 2012; 7 :e34233. doi: 10.1371/journal.pone.0034233. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
38. Atarashi K, Tanoue T, Oshima K, Suda W, Nagano Y, Nishikawa H, Fukuda S, Saito T, Narushima S, Hase K, et al. Treg cảm ứng bởi một hỗn hợp được lựa chọn hợp lý của các chủng clostridia từ hệ vi sinh vật của con người. Thiên nhiên. 2013; 500 :232–236. doi: 10.1038/nature12331. [ PubMed ] [ CrossRef ] [ ]
39. Shin NR, Whon TW, Bae JW. Proteobacteria: dấu hiệu vi khuẩn gây rối loạn vi khuẩn trong hệ vi sinh vật đường ruột. Xu hướng Công nghệ sinh học. 2015; 33 :496–503. doi: 10.1016/j.tibtech.2015.06.011. [ PubMed ] [ CrossRef ] [ ]
40. Ridaura VK, Faith JJ, Rey FE, Cheng J, Duncan AE, Kau AL, Griffin NW, Lombard V, Henrissat B, Bain JR, et al. Hệ vi sinh vật đường ruột từ cặp song sinh không phù hợp với bệnh béo phì điều chỉnh quá trình trao đổi chất ở chuột. Khoa học. 2013; 341 :1241214. doi: 10.1126/khoa hoc.1241214. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
41. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Béo phì làm thay đổi hệ sinh thái vi khuẩn đường ruột. Proc Natl Acad Sci US A. 2005; 102 :11070–11075. doi: 10.1073/pnas.0504978102. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
42. Turnbaugh PJ, Ridaura VK, Faith JJ, Rey FE, Knight R, Gordon JI. Ảnh hưởng của chế độ ăn uống đối với hệ vi sinh vật đường ruột của con người: một phân tích metagenomic ở chuột gnotobiotic được nhân bản hóa. Khoa học Dịch thuật Med. 2009; 1 :6ra14. doi: 10.1126/scitranslmed.3000322. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
43. Đứng đầu DL, Clifton PM. Axit béo chuỗi ngắn và chức năng ruột kết của con người: vai trò của tinh bột kháng và polysacarit không tinh bột. Physiol Rev. 2001; 81 :1031–1064. doi: 10.1152/physrev.2001.81.3.1031. [ PubMed ] [ CrossRef ] [ ]
44. Mayer EA, Knight R, Mazmanian SK, Cryan JF, Tillisch K. Vi khuẩn đường ruột và não bộ: sự thay đổi mô hình trong khoa học thần kinh. Thần kinh học J. 2014; 34 :15490–15496. doi: 10.1523/JNEUROSCI.3299-14.2014. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]
45. Cryan JF, Dinan TG. Các vi sinh vật làm thay đổi tâm trí: tác động của hệ vi sinh vật đường ruột đối với não và hành vi. Thần kinh Nat Rev. 2012; 13 :701–712. doi: 10.1038/nrn3346. [ PubMed ] [ CrossRef ] [ ]
46. Fernandez-Real JM, Serino M, Blasco G, Puig J, Daunis-i-Estadella J, Ricart W, Burcelin R, Fernandez-Aranda F, Portero-Otin M. Hệ vi sinh vật đường ruột tương tác với vi cấu trúc và chức năng của não. J lâm sàng Endocrinol Metab. 2015; 100 :4505–4513. doi: 10.1210/jc.2015-3076. [ PubMed ] [ CrossRef ] [ ]
47. Martin CR, Osadchiy V, Kalani A, Mayer EA. Trục não-ruột-microbiome. Tế bào Mol Gastroenterol Hepatol. 2018; 6 :133–148. doi: 10.1016/j.jcmgh.2018.04.003. [ Bài viết miễn phí của PMC ] [ PubMed ] [ CrossRef ] [ ]

Bài viết từ Lipid trong sức khỏe và bệnh tật được cung cấp ở đây lịch sự của Trung tâm BioMed

Trang web này được bảo vệ bằng reCAPTCHA. Ngoài ra, cũng áp dụng Chính sách quyền riêng tưĐiều khoản dịch vụ của Google.